Purpose:To Construct the siRNA eukaryotic expression plasmids (pGPU6/GFP/Neo)of CDK2 gene,then to transfect in the human hepatocellular carcinoma cells line(SMMC7721).For studying its effect on the CDK2 gene and the related RB,Cyclin E and E2F1 genes in the cell cycle and the assistant action of GAPSGF[Polysaccharides component GF extracted by Ganoderma applanatum(Per.ex Gray)].Methods:The siRNA eukaryotic expression plasmids of CDK2 gene were constructed and transfected into SMMC7721 cells with a lipofection method.The inhibitive effect of CDK2 gene and effective sequence of siRNA was identified with Real-time PCR and Western blot methods. Real-time PCR method was also utilized to detect the mRNA expression of RB,Cyclin E and E2F1 that are related to CDK2 gene.MTT was used to detect the inhibition of GAPSGF in cell proliferation of SMMC7221 and to search the effective dose GAPSGF for anti-tumor in vitro.It was studied that the the effect of GAPSGF on CDK2,RB,Cyclin E and E2F1 mRNA and protein expression of SMMC7721 cell with Real-time PCR and Western blot methods.The assistant effect of GAPSGF was investigated on the inhibition action of RNAi in CDK2 gene.Results:1.The siRNA eukaryotic expression plasmids of CDK2 gene have been successfully constructed that was proved by DNA sequence determination.2.The siRNA eukaryotic expression plasmids of CDK2 gene have been successfully transfected into SMMC7721 cells with a lipofection method. The transfection rate was over 90%.3.Effective siRNA sequence of CDK2 gene were 190: GGAGCTTAACCATCCTAATAT and 191:GACCCTAACAAGCGGATTTCG in SMMC7721 cells.4.The siRNA eukaryotic expression plasmids of CDK2 gene can specificly inhibit mRNA and protein expression in SMMC7721,and the inhibition ratio of siRNA segment 190 and 191 in mRNA expression of CDK2 were 72%and 56%,respectively;and in protein expression of CDK2 were 91.6%and 79.5%,respectively.5.The inhibition of RNAi in CDK2 could influence the related genes expression in cell cycle,The expression of RB gene is raised 56%by SiRNA segment 190,the expression of Cyclin E and E2F1 were reduced 36%and 38%by siRNA segment 191,respectively.6.GAPSGF could obviously inhibit the cell proliferation in SMMC7721 at the effective doses of 2.5μg·mL-1,5μg·mL-1and 10μg·mL-1 The inhibition ratio were 20.01%,20.47%and 24.44%.7.GAPSGF could reduced the mRNA expression of CDK2,CyclinE and E2F1,raised the mRNA expression of RB at the effective doses of 2.5μg·mL-1and 10μg·mL-1.8.Comparing with application of siRNA segment 190 alone,the combining use of 10μg·mL-1GAPSGF and siRNA segment 190 can raise the inhibition ratio of CDK2 protein expression,The inhibition ratio can increase 47.1%;Comparing with application of siRNA segment 191 alone, the combining use of 2.5μg·mL-1GAPSGF and siRNA segment 190 can raise the inhibition ratio of CDK2 mRNA and protein expression,The inhibition ratio can increase 3%and 13.3%,respectively.Conclusion:1.Six pairs of siRNA eukaryotic expression plasmids of CDK2 gene have been successfully constructed by DNA sequence determination.2.CDK2 gene can be specifically silenced by RNAi technique.It is indicated that CDK2 gene may be a new target for treating hepatoma in gene therapy.3.The mRNA expression of RB,Cyclin E and E2F1 genes related to CDK2 gene have obviously dependence on CDK2 gene.Therefore,it indicates that the interference of CDK2 gene is a an effective means for treating hepatoma in cell regulation net.4.GAPSGF can obviously inhibit cell proliferation of SMMC7721 in vitro.The mechanism may be produced by the down-regulation of CDK2, Cyclin E and E2F1 genes expression,and the up-regulation of RB gene expression.5.GAPSGF has certain assistant action for the RNA interfere expression of CDK2.It is demonstrated that GAPSGF could become a new assistant medicine for treating hepatoma in gene therapy.
|