Studies Of The Effect Of Omethoate On The Gene Expression Level Of Agrin Gene In Cultured Dynamoneure | | Posted on:2009-12-14 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:Y Guo | Full Text:PDF | | GTID:1114360245963284 | Subject:Neurology | | Abstract/Summary: | PDF Full Text Request | | Organophosphate poisoning intermediate myasthenia syndrome is defined as the clinical syndrome that occurred in 1~4 days after acute organop- hosphate poisoning, mainly in cranial nerve muscle, neck flexor muscle, the proximal limb muscle and respiratory muscle weakness as the main performance.IMS was first proposed and named by Senanayake and Karalliedde.The main cause of death due to acute organophosphate poisoning is believed to be acute respiratory failure caused by IMS.The pathogenesis of IMS is unclear.The neuromuscular junction block due to organophosphate poisoning was proved by electrophysiological studies. Experimental evidence recently obtained suggests that organophosphate poisoning damage mitochondria chondrosome,endoplasmic reticulum of myocyte,and could lead to reduced neuronal axons,extended dendrites.Agrin is a proteoglycans distributed in the central nervous system, the neuromuscular junction, etc.It expressed in body of avians rodents and homo-sapiens.Agrin secreted by motor axons signals the muscle cells and lead to a dense aggregate of acetylcholine receptors (AChRs) on the postsynaptic membrane.It is necessary for the formation of neuromuscular junctions(NMJs) and important to the occurrence,extend and maintain of axonsThe rat dynamoneures were purificated by differential adherent and cultured in the serum-containing medium.By optimizing the purification conditions and cell culture condition, SMI-32mAb immunohistochemical staining identified more than 90% of the cultured cells was motor neurons.Organophosphorus pesticide was used to interfere with the rat dynomoneure cultured in vitro.Thus discuss further the pathogenesis of intermediate syndrome on pre-synaptic neurons and detect and analyze the effects of omethoate on the transcriptional level and expression of agrin gene.The probability of organophosphate poisoning affecting agrin gene of the dynamoneure will be concluded here.The Chimeric fluorescent Real-Time PCR was devised and verificated to quantitate rat agrin mRNA.The perfect Real-Time PCR primers to detect rat agrin mRNA and rat ACTB mRNA was designed by Primer3 software. After the specificness of the perfect Real-Time PCR primers was proved in BLAST, the primer to construct standard preparation of rat agrin mRNA was designed by Primer5 software.The primers of Real-Time PCR was seted:Rat agrin mRNA sense5`-gaaggccaggtgcgaatca-3`,antisense5`-cacaggtagcagtggagccaag- 3`,internal standard:Rat ACTB mRNA sense 5`- ggagattactgccctggctccta -3`,antisense 5`-gactcatcgtactcctgcttgctg-3`。The standard preparation of Real- Time PCR was RAT agrin mRNA 1840-2398bp sequence.The expression of agrin gene in the rat of birth stage was of a high level and reached a peak on the 4th day.Wistar rat mated to get neonate rat. After operation, brain tissue of 4days neonate rat was used for mRNA. The reverse transcription polymerase chain reaction was performed to obtaine standard preparation DNA of rat agrin. After T7 promotor was connected to rat agrin DNA by PCR, standard preparation of rat agrin mRNA was constructed by T7 RNA Polymerase. Digested the DNA and detected the concentration of standard preparation of rat agrin mRNA. Diluted the rat agrin mRNA by multiproportion of 1:5 and obtein standard preparation of rat agrin cDNA by reverse transcription reaction.The standard preparation of rat ACTB mRNA was constructed by reverse transcription reaction while the perfect Real-Time PCR primer was used. Diluted mRNA by multiproportion of 1:5 and obtein standard preparation of rat ACTB cDNA. Definited and optimized PCR proceed.The rate of dependablity about the standard curves of rat agrin mRNA or rat ACTB mRNA>0.95.In addition to electrophoresis of the Real-Time PCR products,sequencing were performed to test theirs specificness.This research aims to identify the relationship between organophosphate poisoning and forming and maintenance of neuromuscular junction.By analyzing the results of electrophoresis,the result of sequencing Real-Time PCR products and dilapsus curve of Real-Time PCR,the specificness of the method was verificated. and repeatability of the method was tested.Real-Time PCR was performed to quantitate the concentrations of agrin mRNA in rat dynamoneures that was normally cultured and that were 0.1mmol/L or 0.01mmol/L or 0.001mmol/L omethoate exposured 40minuts or 24hours.To determined the effects of different concentrations of omethoate poisoning on the agrin gene translation level of rat dynamoneures,western blot analysis of agrin levels in whole cell extracts obtained from normal cultured rat dynamoneures and motor neurons that were poisoned in 0.1mmol/L, 0.01mmol/L,0.001mmol/L omethoate was performed and ACTB was used as a internal control.It was determined by the result of statistical treatment:(1) The mRNA transcripitional level of agrin gene in the group normally cultured rat dynamoneure was higher than that of the group poisoned with omethoate;(2)There was significant deviation in different groups with different density of omethoate poisoning.The transcriptional level of agrin gene in 0.1mmol/L omethoate poisoning motor neuron group was reduced compared with that of dynamoneure group in 0.01mmol/L omethoate poisoning,while the agrin mRNA level in 0.01mmol/L omethoate poisoning dynamoneure group was lower than that in 0.001mmol/L omethoate poisoning.And there is positive correlation between the damage degree of transcriptive level in dynamoneures and the dose of organophosphorus pesticide;(3)24hours after dynamoneures were poisoned by omethoate,the level of agrin expressed in normally cultured rat dynamoneure group was significantly higher than that of motor neuron group in 0.1mmol/L omethoate poisoning,while the agrin protein presented in 0.01mmol/L omethoate poisoning motor neuron group was reduced compared with that of dynamoneure in 0.001mmol/L omethoate;(4)The agrin protein presented in 0.1mmol/L omethoate poisoning motor neuron group was a trace expression.There is positive correlation between damage degree of the expresive level in dynamoneures and the dose of organophosphorus pesticide.This research findings is consistent with previous electrophysiolo- gical studies about IMS.Conclusion of this research : Organophosphorus pesticide has an predominant effect on the expresion of agrin gene and there is positive correlation between the level of the damage and the concentration of the organophosphate pesticide. | | Keywords/Search Tags: | Rat, dynamoneure, cell culture, agrin gene, ACTB gene, Real-TimePCR, Western Blot, transcription, translation, organophosphate poisoning, neuroglia cells | PDF Full Text Request | Related items |
| |
|