Font Size: a A A

Assessment Of Genetic Diversity And Characterization Of Naked Gene And Dwarf Gene In Cucurbita Moschata Using Molecular Markers

Posted on:2012-01-14Degree:DoctorType:Dissertation
Country:ChinaCandidate:J X WuFull Text:PDF
GTID:1223330368989827Subject:Botany
Abstract/Summary:
Cucurbita moschata Duchesne is a traditional vegetable crop with broad nutritional and economic importance, which is grown for their seeds, immature and mature fruit, traditional medicine, decoration, and processed products. Storage and transport easily. C. moschata is also a morphologically diverse vegetable crop and varies widely in fruit characters. Mexico and northern South America have been proposed to be independent domestication centers. A more recent archaeological discovery dating from 7660 BC from the western slopes of the northern Peruvian Andes. The first historical record of C. moschata in China appeared in the late 16th century. China is currently the major producer and consumer of Cucurbita (Cucurbita moschata, Cucurbita maxima, Cucurbita pepo) in the world. The number (more than 1,000 accessions) of C. moschata accessions held in China is more than that in U.S. National Plant Germplasm System (777 accessions) or Spain (272 accessions). In addition, the naked seed and dwarf vine traits were found in accessions from the Shanxi Province. Despite of having rich Germplasm, little information is available on the development and history of different types of C. moschata accessions, lack of means to accurare reveal the genetic variation. Use of C. moschata germplasm from China is scant in international reports. Previous studies of the genetic variability in C. moschata in China have focused on the establishment of the phylogenetic relationships with the other Cucurbita species. A systematic comparison of the Chinese accessions with those from other countries has not been conducted, and research in regard to morphological traits, agroclimatic regions of origin, or breeding needs is lacking. Molecular studies of Cucurbita moschata naked and dwarf traits are started. Although many molecular characterization studies have been conducted for preserving genetic resources in many countries, the number of informative markers is limited. Study on the exploration and utilization of germplasm resources is relatively weak. Base on variability in fruit characteristics, geographical origin and breeding purposes using molecular marker and agronomic traits methods, the relationship between local Chinese C. moschata accessions and those from other countries was discussed. Structure, variability and potential of germplasm in China were revealed. The relationship with C. maxima was also discussed. It will provide extensive background materials and resource utilization for genetic improvement. Data have international and comparability. A preliminary study on the naked and dwarf traits using AFLP and SSR markers will provide a good technical support for fine mapping.The results as follows:1. Cucurbita moschata displays great diversity. Seventy-four Chinese accessions and 15 accessions from other countries were selected for evaluation based upon variation in fruit traits and geographical origin of molecular diversity with AFLP analysis. Nine pairs of EcoRI/MseI primers produced 500 fragments, of which 75.57% were polymorphic, indicating a high degree of diversity. The accessions from China were classified into two clusters, which were clearly differentiated from the accessions originating from Mexico, Guatemala, Honduras, and Ecuador. Chinese group genetically more closely related to other Asian countries group (India and Japan). In general, the accessions from the Americas had a greater number of unique loci than those from China. The differences probably due to a limited number of introductions and genetic drift. The Americas are the center of origin of C. moschata and therefore more diverse. With AFLP analysis, the accessions did not clearly group according to fruit shape; however, sub-clusters exist in acorn- and dumbbell-shaped accessions.10 fruit shapes were classified into two clusters, which the closed genetic distance between flat shape and round shape. Elongate shape is farther than other fruit shape. The assessment of genetic distance, along with some unique traits among the different genotypes, could be useful in further genetic studies and the selection of the most adequate accessions for use in breeding programs.2.52 C. maxima accessions based on the fruit traits and important regions of C. maxima practices were evaluated with AFLP analysis. Ten EcoRI/Msel primer combinations generated 274 AFLP fragments and 55.54% were polymorphic. Genetic similarity coefficients among these accessions ranged from 0.961 to 0.819. Gene diversity ranged from 0.1187 (EcoRI-ACT×MseI-CAT) to 0.2192 (EcoRI-ACA×MseI-CC), with an average of 0.1586 per primer combination. The Shannon’s information Index (I) ranged from 0.3220 (EcoRI-ACA×MseI-CC) to 0.1896 (EcoRI-ACT×MseI-CA), with an average of 0.2409 per primer combination. A certain distribution of these accessions based on fruit flesh color was observed by AFLP analyses, such as white flesh morphological type and orange flesh accessions. Different fruit shapes were not grouped into the distinct cluster. Shannon’s information index of different geographical groups was 0.0795-0.2244. The group from Jinnan region in Shanxi province possessed the highest level of genetic diversity, followed by Xinzhou region in the same province. Molecular variation among groups was about 6%, and 94% within group (P<0.01). C. maxima display diversity. The average polymorphic proportion was lower than those obtained from the C. Moschata by previous experiment.3. Two AFLP analysis system and SSR analysis system in C. Moschata were improve and perfect, four F2 (dwarf) and F2 (nake) were built. DNA were adding PVP andβ-mercaptoethanol modified CTAB method; 5.5 h can be meet digestion and ligation reactions; Diluted 5 times for products of digestion and ligation reactions and diluted 30 times for products of pre-amplification can be meet AFLP experimental conditions.96 primers screened, reproduce, clear polymorphic bands were obtained between dwarf and vine inbred lines. It laid good foundation to tropic pumpkin dwarf vine mapping. Qinpi (vine), drawf 14-1, Taigu tropical pumpkin (vine), drawf (13-1) were screened by 24 SSR markers. Qinpi and drawf 14-1, Taigu tropical pumpkin and drawf (13-1) grouped together. m-26 (ATCATGGGGTGAACAGAAG, GTGACCTATTCCATTGGTTCC) gave clear banding patterns with polymorphism between Qinpi and drawf 14-1.It also screen different in F2. It laid further dwarf research.Based on naked character genetic analysis and a study between two naked kernel Cucurbita moschata and ten shell kernel Cucurbita varieties, the results showed that the naked kernel character was controlled by a recessive gene. Average naked seed length varied from 16.75 to 19.01 mm; seed width varied from 9.11 to 9.62 mm, and average seed weight (100 seeds) ranged from 20.73 to 23.90 g. About more 20% kernel percentage than shell kernel of the same size pumpkin, and kernel weights is lightly less than the larger seed of Cucurbita maxima. Transformation breeding and nutrition analysis through different materials could be useful in further special varieties selection in naked kernel color, kernel size and different market demand. SSR marker(TGAGGAAGAAACTAAAACTGAAACAA,ACCATTTCAAACCCACATCAG) of nake Cucurbita moschata which obtained by Gong (2008) was used to check our F2,between nake and shell kernel plants, different bands were produced. Preliminary analysis that this SSR marker can be used our nake trait identification in younger plants.
Keywords/Search Tags:Tropical pumpkin, AFLP marker, SSR marker, Genetic diversity, Naked and Drawf trait
Related items