Liver cancer is one of the most common malignant tumors in the world,80~90%of them are hepatocellular carcinoma(HCC). According to relevant data, the morbidity and mortality of liver cancer is the sixth and third in all malignant tumors. Each year, There are about626,000new cases and598,000fatalities because of HCC in the world. HCC is a kind of malignant tumor originates from liver cells. Viruses infection(HBV and HCV), non viral factors, alcohol and aflatoxin intake, cirrhosis of the liver contribute to HCC, while the HBV infection is the major cause in China.The exact mechanisms of HCC still remain unclear. At present, the most persuasive consensus is the unbalance between anticancer gene inactivation and cancer gene activation.miRNA is a class of non-coding small RNA, which generally regulates gene expression in the post-transcriptional process. Recent studies showed that miRNA regulation plays an important role in health and disease. Abnormal expression of miRNAs may lead to occurrence and development of tumors. Some researches indicated that the incidence, development, treatment, prognosis and recurrence of HCC are related to expression of some certain abnormal miRNAs. Hence researchers believe that miRNAs could help them to find out pathogenesis, explore the basis for molecular diagnostics, evaluate the prognosis and provide new treatment options for HCC. miR-199a is highly conserved, its expression is different in various tumors. In recent years, the relations between miR-199a and tumor have attracted more and more attentions. For example, the expression of miR-199a was down-regulated in oral carcimoma tissues suggested that there may be a close link between oral cancer incidence and miR-199a. Some other researches showed that miR-199a participates in the occurrence and development of HCC by regulating the expression of its target genes. The increased expression of miR-199a may inhibit the development of HCC. miR-21is another typical carcinogenic miRNAs. Studies showed that miR-21is overexpressed in a number of tumors, such as breast cancer, lung cancer, colon cancer and glioblastoma.The overexpression of miR-21can promote the invasion and migration of liver cancer cell, because the tumor suppressor gene PTEN is a target gene of miR-21. miR-21is also be called carcinogenic miRNA, because its function is similar to oncogene to some extent. miR-221is also a promising small RNA which has a upregulated trend in a number of tumor cells, such as hepatocellular carcinoma, bladder cancer, papillary thyroid cancer, glioblastoma and pancreatic cancer. It inhibits the expression of cyclin-dependent kinase inhibitor, transforms tumor cells from G1phase to S phase and promotes growth of cancer cells. The different expression of miRNA-21, miRNA-221and miRNA-199a in HCC suggested that they may become a potential combinant target for clinical diagnosis and treatment of HCC.Microbubble ultrasound contrast agent is a safe, new, stable and efficient gene transfer vector. Gene is located in ultrasound microbubble, and then released when the bubble broke. Microbubble destruction from vibration was able to increase the permeability of local cells and produce a reversible sound hole, which can promote gene into the nucleus and increase its expression and transfection. Moreover, microbubbles have a protective effect, which can carry the genes or drugs to avoid blood endonucleases and other degradation of the enzymes. The genes or drugs reach the target tissue or target organ through the blood circulatory system finally. The target effect of ultrasound microbubble largely reduces the systemic adverse reactions.Now the basic research and clinical application of ultrasound microbubble mainly focus in cancer and anti-tumor therapy, thrombosis and thrombolytic therapy, inflammation, carrying drugs, gene therapy and other fields. Microbubble technic can improve gene transfection that had been widely demonstrated. It is a new way for cancer treatment.Because of the potential significance of the miRNA-21, miRNA-221and miRNA-199a in the molecular mechanisms of liver carcinogenesis, the purpose of this study is to clarify transfection efficiency and safety of the ultrasound microbubble destruction which mediate antisense miRNA-21/221and miRNA-199a plasmid transfecting into HepG2cells. In addition, we try to explore the role of the abnormal expression of miRNAs in the development process of HCC and the feasibility of ultrasound microbubble-mediated gene therapy.Materials and Methods1. Construction of recombinant vectors expressing antisense miRNA-21, miRNA-221and miRNA-199a.According to the sequences of hsa-miR-21-5p and hsa-miR-221-3p, the corresponding antisense sequence were constructed as TCAACATCAGTCTGATAAGCTA and GAAACCCAGCAGACAATGTAGCT. Meanwile, the sequences of miRNA-199a-1was inspected from National Center of Biotechnology Information (NCBI). Then we constructed recombinant plasmid vectors of antisense miRNA-21, antisense miRNA-221and miRNA-199a.2. Measurement of effects of ultrasound sulfur hexafluoride and perfluoropropane microbubbles on cell viability By MTT and trypan blue methods respectively. Optimal ultrasound microbubble was screened out.HepG2cells were seeded in a96-well cell culture plate which contained1.0x104cells, cultured for24h and observed. When the cells were in the logarithmic growth phase and the area of adherent cells was80%or more, washed the cells with PBS carefully and added serum-free cell culture medium DMEM200μl. Then added the appropriate volume of six fluorinated sulfur and perfluoropropane microbubble, the concentration of ultrasound contrast agent were set up at1%,5%,10%and20%respectively. The control and blank groups were applied simultaneously. The cell activity and viability were detected by MTT assay.Under different cell concentration, HepG2cells which were in the logarithmic growth phase were seeded in6orifice plate after adjusting the cell concentration to1×105/ml and2ml per hole. The control group was applied simultaneously and the cell survival rate was observed by trypan blue assay.3. miRNA-199a plasmid transfection: HepG2cells were transfected by the miRNA-199a plasmid in ultrasound sulfur hexafluoride microbubbles and perfluoropropane respectively. Flow cytometry and fluorescence microscopy were used to screen the optimal condition of ultrasound microbubble mediated miRNAsThe cells were cultured according to the above steps of experiment2and the Optimal ultrasound microbubble was screened out in experiment2. Ultrasound probe was placed in the bottom of culture plate and added a small amount of coupling agent; In the Ultrasonic imaging mode, the supersonic frequency was set at2.0MHz, mechanical index was0.12,0.20,0.28, and0.35, irradiation time was30seconds. The cells were cultured with DMEM which contained10%FBS after6to8hours. GFP signal was observed under fluorescence microscope and the transfection efficiency was measured by flow cytometry when transfected after24to48hours. The best conditions of microbubble mediated transfection was screened out.4. Antisense miRNA-21, antisense miRNA-221and miRNA-199a plasmids were transfected into HepG2cells on the optimal ultrasound microbubble mediated condition. We set up a blank control group and a negative control group which were added plasmid without ultrasound microbubble and ultrasounic irradiation. Each gene expression in HepG2cells was detected by PCR technology.5. Antisense miRNA-21, antisense miRNA-221and miRNA-199a plasmids were transfected into HepG2cells on the optimal ultrasound microbubble mediated condition. The blank control group and negative group were applied simultaneously. Cell viability was detected by MTT assay.6. The cell apoptosis and cycle distribution were detected by Annexin V-PE/7-AAD double staining and Annexin V-PI double staining respectively.Antisense miRNA-21, antisense miRNA-221and miRNA-199a plasmids were transfected into HepG2cells on the optimal ultrasound microbubble mediated condition. The blank control group and negative group were applied simultaneously. The cells were cultured with DMEM which contained10%FBS when transfected after6to8hours, added trypsin after24to48hours. Collected carefully, Added an appropriate amount7-AAD dye, away from light reaction for5-15mins, in accordance with the instruction of Annexin V-PE double dye, HepG2cell apoptosis was tested. Added an appropriate amount PI dye, HepG2cell cycle distribution was detected. 7.The experiments of scratch and Transwell were used to detected cell migration.Antisense miRNA-21, antisense miRNA-221and miRNA-199a plasmids were transfected into HepG2cells on the optimal ultrasound microbubble mediated condition. The blank control group and negative group were applied simultaneously. The cells were cultured with DMEM containing10%FBS When transfected after4h. Cells were washed three times with PBS, incubated in5%CO2incubator and sampled at Oh,12h. The transwell Chambers was Prepared and the cells digested, each hole was joined cell suspension. Incubated in37℃incubator for20to24h, removed transwell Chambers and fixed, then dyed. Cells were washed twice with PBS before and after incubation, observed with microscope and counted with random five field.8. Antisense miRNA-21, antisense miRNA-221and miRNA-199a plasmids were transfected into HepG2cells on the optimal ultrasound microbubble mediated condition. The colony-forming ability of cells was measured. The blank control group and negative group were applied simultaneously. The cells were cultured with DMEM containing10%FBS When transfected after4h.1.2%low melting point agarose and2×DMEM were mixed in a1:1volume,1.4ml of that was added to6well plate and solidified. The cells were digested to a density of1×104/ml.0.6%low melting point agarose and2×DMEM was prepared by mixing in a1:1volume, lml of top agar and0.1ml of cell suspension were added into the six well plate, cultured conventionally. The cell colony were observed and counted.Result1.The antisense miRNA-21, antisense miRNA-221and miRNA-199a vector which used GV249plasmid as the backbone was constructed with restriction endonucleases and PCR methods. Plasmid was extracted by plasmid extraction kit, sequenced by The Shanghai Invitrogen Biotechnology Co. The results showed that the sequences were correct entirely.2.The results of MTT and trypan blue assay were consistent. With the concentration of microbubble contrast agent increased, cell activity decreased, there were statistically significant difference between these groups (P<0.05). When the concentration of microbubble contrast agent was less than10%, both the sulfur hexafluoride and perfluoropropane microbubbles would not cause significant cell death (Cell viability>80%). Cell lethality was enhanced significantly (Cell viability<70%) when the microbubbles concentration was up to20%. The toxic effect of the two kinds of microbubbles on cells were the same.3.The plasmids of target genes were transfected into HepG2cells in vitro. The transfection efficiency was detected by the method of flow cytometry and fluorescence microscopy. The results of that were consistent;①Contrast agents can significantly improve the gene transfection under the conditions of the same ultrasonic frequency and mechanical index. The transfection efficiency of group Plasmid+US+SF6and plasmid+US+C3F8were significantly higher than the Plasmid+US group (P<0.05).②When other transfection conditions were unchanged and mechanical index were0.12,0.20, and0.28respectively, the transfection efficiency increased with the mechanical index increased. The transfection efficiency of group Plasmid+US+SF6was the highest when the mechanical index was0.28, however, the efficiency decreased significantly when the mechanical index was0.35. There was statistically significant difference between each groups (P<0.05).③Naked plasmid cound not transfected into cells. The ultrasonic irradiation can promote plasmid transfected into cells. When added ultrasound microbubble, the efficiency of transfection was significantly improved. The transfection efficiency of group Plasmid+US+SF6was the highest when MI was0.28, reached (26.31±0.72)%, which was significantly higher than the normal lipofection rate (24.70±0.67)%(P<0.05).4.The plasmids of target genes were transfected into HepG2cells in vitro. The genes expression of aso-mir-21/221group were inhibited and raised in mirl99a group, there was significant difference when compared with the control group and negative control group (P<0.05), however, there was no statistical differences between blank control group and negative control group (P>0.05).5. The plasmids of target genes were transfected into HepG2cells in vitro. The growth of control group and negative control group were not reduced and inhibited in the groups of mir-221, mir-21and mir-199a, there was significant difference compared with control group (P<0.05). The inhibitory of mir-199a group was the most obviously and there was statistically significant difference Compared with other groups (P<0.05).6.The proportion of apoptotic cells of the control group was0.46%. However, the proportion of apoptotic cells increased slightly, which was less than2%after transfected with empty plasmid. The gene of aso-mir-21, aso-mir-221and mir-199a were transfected into HepG2cells, the cell apoptosis rate were (7.49±0.42)%,(7.96±0.33)%and (11.10±0.46)%respectively, the apoptotic peak of group mir199a appeared, the apoptosis was higher than other group, the difference was statistically significant.(P<0.05).7.Cell migration was decreased after the target plasmid transfection, which was less than80%of normal group. Compared with the control group, the cell migration of aso-mir-21group, aso-mir-221group and mir-199a group were59.08%,46.57%, and31.01%respectively. The interference effect of mir-199a group was the strongest in these three groups, the difference was statistically significant (P<0.05). Transwell experimental results show that the average visual field of HepG2cells were significantly decreased than negative control group and the control group after the purpose gene plasmid transfected (P<0.05). The inhibition effect of mir-199a transfection cell group was higher than other groups, the invasion cells of per average was38.67±4.51a vision, the difference was statistically significant (P<0.05).8. After the target plasmids were transfected, the clonality of aso-mir-21group, aso-mir-221group and mir199a group reduced significantly (P<0.05), the clonality of mir-199a group was105.67+5.86, the inhibitory of mir-199a group was the most obviously and there was statistically significant difference Compared with other groups (P<0.05).Conclusion1. The results of MTT and trypan blue assay were consistent that sulfur hexafluoride microbubbles and perfluoropropane would not cause cell death significantly (Cell viability>80%), when the concentration of microbubble contrast agent was less than10%.2. At the optimal microbubble concentration (10%), the optimal sound intensity (ultrasonic frequency:2.0MHz, MI:0.28, Ultrasonic irradiation time:30s), the transfection efficiency of group Plasmid+US+SF6could be achieved (26.31±0.72)%, and the transfection efficiency was significantly higher than conventional liposomal transfection.3. The plasmids of target genes (aso-mir-21, aso-mir-221and mir-199a) were transfected into HepG2cells in vitro. The growth of transfected cells were inhibited significantly; the cells were apoptotic; cell migration was decreased after the target plasmid transfection, which was less than80%of normal group; the clonality reduced significantly. The experimental effect of mir-199a cell group was the most significantly.4. Ultrasound microbubble mediated antisense miRNA-21/221and miRNA-199a plasmid transfected into HepG2cells with good transfection efficiency. The cell growth, migration and colony forming ability of transfected tumor cells were suppressed, which laid a solid foundation for the miRNA vivo inhibition experiments. |