A Study Of Expression Of S100A4/S100A12 In HASMC And Its Regulatory Effect On Proliferation,Apoptosis And Damage Repair Of HASMC

TAD is a serious cardiovascular disease.It has been reported that the death rate of TAD patients who did not receive treatment in the first week of the disease has reached 70 percent.At present,although the diagnosis and treatment of TAD has made great progress,its pathogenesis is still unclear.Therefore,its morbidity and mortality rate is still very high.The normal media aorta is mainly composed of HASMC(human aortic smooth muscle)and ECM(Extracellular matrix).The interaction between the two plays an important role in the integrity of aortic wall structure and function.TAD is the end of aortic VSMC structure and dysfunction.Transforming growth factor(TGF)may activate Smads protein and induce the expression of vascular connection protein and connective tissue growth factor in VSMC,thus promotes the deposition of ECM and forming TAD.In cells,calcium binding protein S100A4 regulates the functions of cytokines and signaling proteins involved in cell movement,invasion,growth and angiogenesis.S100A4 protein promotes VSMC cell proliferation and migration through RAGE receptors,and S100A12 as the same family with S100A4,is one of the ligands of RAGE,and can also participate in the formation of TAD.In our later part of the study,we mainly discussed the expression of S100A12 in HASMC and its HASMC proliferation,apoptosis and modulation of injury repair.In our previous study,the level of S100A12 could be used as a biomarker for predicting cardiovascular events and perioperative complications in TAD patients.S100A12 in apolipoprotein ApoE mice was a biomarker for predicting cardiovascular events and perioperative complications.Significant vascular calcification was detected in this S100A12 transgenic mouse model.On the wall of the aorta,the proliferation of osteoblasts was expressed and oxidative stress was produced.In order to investigate the expression and regulation of S100A4/S100A12 in HASMC and thoracic TAD tissues,our study consists of three parts:The first part:A Study of The expression and Regulation of S100A4 in HASMC and TAD tissuesThe expression of S100A4 in 11 patients with TAD and 9 normal aortic tissues was detected by RT-qPCR and western blot.Results the mRNA expression and protein expression of S100A4 in patients with TAD was significantly higher than that in normal aortic tissues.The levels of TGF ?1,TGF ?2,Smad2/3 and Smad4 were detected by western blot.Results the levels of TGF ?1,TGF-? 2,Smad 2/3 and Smad4 protein in TAD group were significantly higher than those in normal aortic tissue.Compared with the normal aortic tissue,the protein levels of MMP-2,MMP-9,VCAM-1,SM-MHC and SM-a-actin were detected by Western-blot.Compared with the normal aortic tissue,we found that MMP-2,MMP-9 and VCAM-1 in aortic tissue of TAD patients increased significantly,while SM-MHC and SM-a-actin decreased significantly.At the cellular level,S100A4 over expression vector and empty vector was successfully transfected into VSMC,S100A4 mRNA and protein levels were significantly higher than the control group.we will detect cell proliferation in S100A4 overexpression group VSMC detected by MTT,the results showed that S100A4 transfected with VSMC,cell proliferation was significantly lower than the control group.Transfected with S100A4 VSMC apoptosis detection used flow cytometry by AnnexinV-FITC/PI,overexpression S100A4 VSMC group,the percentage of apoptotic cells was significantly higher than the control group,S100A4 The effect of S100A4 on the expression of TGF ? 1TGF-? 2,Smad2/3 and Smad4 in VSMC and its phosphorylation state were detected by western blot.The results showed that the expression and phosphorylation of TGF ? 1 TGF-? 2,Smad2/3 and Smad4 in VSMC were significantly increased after S100A4 overexpression.The protein levels of MMP-2,MMP-9,VCAM-1,SM-MHC and SM-a-actin in VSMC were detected by Western blot.The levels of MMP-2,MMP-9 and VCAM-1 protein in VSMC of S100A4 overexpression group were significantly higher than those of control group.The levels of SM-MHC and SM-a-actin protein were significantly lower than those of the control group.The second part:the effect of reduce S100A12 expression on the repair ofHASMC induced by oxidative stress of H2O2H2O2 can increase HASMC oxidative stress level and HAVMC apoptosis,resulting in aortic vascular desease,like TAD et.al.Inhibition of VSMC apoptosis may be an important strategy for the future treatment of TAD.In order to elucidate the role of decreased S100A12 expression in the formation of aortic diseases,we study the influence and function of HASMC damage induced by H2O2 after reducing the expression of S100A12.After transfection of S100A12 interference vector pGPU6/GFP/Neo-sh S100A12(target sequence:CTAAGGGTGAGCTGAAGCAG)and negative control pGPU6/GFP/Neo-shNC2(target sequence:GTTCTCCGAACGTGTCACGT),we found that the expression level of S100A12 in shS100A12 group was significantly lower than that in shNC group.In order to study the effect of reduced S100A12 on cell proliferation,four groups of HASMC proliferation level were divided detected by MTT:transfection of S100A12 interference vector,shNC and H2O2 stimulation,shS100A12 transfection and H2O2 stimulated,shNC transfection negative control.Compared with the shNC group,the proliferation ability of HASMC stimulated by H2O2 decreased significantly(P<0.01).Compared with shNC H2O2 group,the proliferation ability of shS100A12 transfected H2O2 group increased significantly(P<0.05).To investigate the effect of VSMC on releasing IL-6 and TNF ? after H2O2 induced,ELISA was used to detect the expression level of IL-6 and TNF ? in the supernatant of HASMC.Compared with shNC group,the level of IL-6 TNF-a in HASMC of shNC H2O2 group was significantly increased(P<0.01).Compared with the ShNC + H202 group,HASMC produced IL-6 and TNF alpha decreased significantly in S100A12 transfection + H2O2 group,(P<0.01).The results showed that the production of IL-6 in shNC H2O2 group was significantly lower than that in ShNC H2O2 group(P<0.01).The results showed that H2O2 induced increased levels of IL-6 and TNF ?,leading to inflammatory reaction.However,reducing S100A12 level can reduce and protect HASMC damage induced by H2O2.H2O2 could induce apoptosis of VSMC.However,it is not clear whether S100A12 can inhibit the apoptosis induced by H2O2.The apoptosis level dectected by AnnexinV-FITC/Pi flow technology,and the apoptosis level is significant higher than it in H2O2 group(P<0.01).Compared with shNC H2O2 group the apoptosis level in HASMC cell of S100A12 transfected H2O2 group was significantly lower than that of shNC H2O2 group(P<0.01).The results showed that the reduction effect of S100A12 could prevent the apoptosis induced by H2O2.Caspase-3 is a member of the cysteine-aspartate protease caspase family,and is the most important nucleic acid cleavage enzyme in the apoptosis pathway.Bcl-2 is considered to be an important anti-apoptotic protein.The expression of cysteine aspartate protease 3 and Bc1-2 was detected to evaluate the apoptosis of human vascular smooth muscle cells induced by H2O2.H2O2 induce the increased the protein level of Caspase-3 in HASMC,but significantly decreased the level of Bcl-2.Compared with shNC H2O2 group,the caspase-3 expression of HASMC in S100A12 H2O2 group was significantly decreased,while the Bcl-2 level was significantly increased.The results showed that H2O2 could induce apoptosis of HASMC,but decreased S100A12 expression level could reduce and repair the apoptosis.The third part:blocking ERK1/2 signaling pathway can inhibit HASMC damage induced by S100A12.S100A12 participates in a variety of cellular and extracellular inflammatory processes.By inhibiting the ERK signaling pathway,it inhibits the activity of pro-inflammatory and anti-inflammatory cytokines in cells.It was found that reducing the expression level of S100A12 could inhibit the activity of proinflammatory and anti-inflam-matory cytokines.After transfection of HASMC with S100A12 overexpression vector pMD18-T-S100A12 and empty vector,pMD18-T-S100A12 HASMC was treated with 20 p,M SB203580(p38 MAPK inhibitor)or 10 ? M PD98059(ERK1/2 inhibitor),respectively.Then the effect of S100A12 on HASMC was tested.AnnexinV-FITC/Pi flow cytometry and MTT assay were used to detect the changes of HASMC apoptosis and proliferation.Compared with EV control group,the apoptosis of HASMC overexpression group of S100A12 increased significantly.The proliferation of HASMC decreased significantly after transfection of pMD18-T-S100A12.It was found that the levels of MMP-2,MMP-9 and VCAM-1 in HASMC transfected with pMD18-T-S100A12 were significantly higher than those in the control group.The effect was completely eliminated by PD98059,but the effect was not completely eliminated by SB203580.ERK1/2 signaling pathway was up-regulated by S100A12,while PD98059 inhibited S100A12-induced ERK 1/2 activation,which suggested that ERK 1/2 was involved in S100A12-induced HASMC apoptosis.In order to investigate whether inhibition of ERK1/2 signaling pathway can attenuate HASMC damage induced by S100A12,apoptosis and proliferation were detected by AnnexinV-FITC/Pi flow cytometry and MTT assay respectively.Compared with S100A12 group,HASMC apoptosis and proliferation increased significantly in S100A12 PD98059 group.The results showed that inhibition of ERK1/2 signaling pathway could attenuate HASMC damage induced by S100A12.These data suggest that ERK1/2 is involved in the expression of MMP-2,MMP-9 and VACM-1 protein in HASMC induced by S100A12,thus promoting the development of TAD.On the contrary,blocking ERK1/2 inhibits the expression of MMP-2,MMP-9 and VCAM-1 induced by S100A12 and blocks the progression of TAD.Conclusion:1.Our research studies the expression level of S100A4 in HASMC and TAD aorta.It was found that S100A4 was highly expressed in HASMC.S100A4 inhibited HASMC activity,induced cell apoptosis,increased MMP enzyme expression and led to ECM degradation by activating TGF?/Smad signaling pathway.And overexpression S100A4 can promote the development of TAD.2.The reduction effect of S100A12 can repair the decrease of HASMC activity induced by H2O2,decrease the apoptosis induced by H2O2,and protect HASMC S100A12 as a target may be used in the treatment of TAD in the future,3.S100A12 could increase the expression of MMP-2/MMP-9 and vascular cell adhesion molecule 1(VCAM-1)in HASMC by activating ERK1/2 signaling pathway,resulting in HASMC damage.Therefore,ERK1/2 antagonist may be used as a new drug for the treatment of thoracic aortic dissection.