Adaptation of cell wall and membrane biogenesis to anaerobic and cold shock stress in S. cerevisiae

We have described the process of S. cerevisiae adaptation to anaerobic and low temperature growth and identified the members of transcriptional mechanism controlling this adaptation. We showed that during shift to low temperature or anaerobiosis yeast change the spectrum of mannoproteins on their surface, replacing major vegetative cell wall proteins, Cwp1 and 2, with dan/tir mannoproteins. This process was shown to be essential for anaerobic cell survival.; We have identified a set of transcription factors that regulate the expression of dan/tir genes. The function of these factors is to induce expression under anaerobic conditions and to stringently repress expression in the presence of oxygen. Mox4 is an essential activation factor for this regulon, and Mox1 and Mox2 are repression factors. We showed that Mox4 functions downstream of Mox1 and Mox2. We have characterized the activation sequence, AR1, which is present in promoters of all dan /tir genes. We showed that this sequence is both necessary and sufficient for gene expression. We demonstrated that Mox4 acts through AR1 sequence.; We have characterized OLE1 as a stress response gene, which is induced during anaerobic and cold shock conditions. We investigated the nature of the signal that might be involved in the regulation of OLE1 gene. We found that AcylCoAs are not involved in low-temperature regulation of OLE1 gene induction, though it is still possible that acyl CoAs participate in anaerobic OLE1 regulation. We have shown that drop in membrane fluidity is one of the potential signals for OLE1 induction, especially during low temperature.; We have characterized the mechanisms of OLE1 gene induction on the level of mRNA. We showed that induction of OLE1 during both low temperature and cold shock is regulated at the level of transcription (vs. mRNA stability). We have identified a sequence (GGGCTTCCGTAGAAGAAAAA) in the OLE1 promoter involved in transcriptional activation. Search of S. cerevisiae complete genomic sequences revealed that this region is also present in the promoter of TIP1 gene, which is regulated in parallel with OLE1 during cold shock, anaerobiosis, and response to exogenous fatty acids (data not shown).