| Since 70th in twenty centry when the technology of gene cloning was build, it has been greatly improved. Now, many exogenous genes have been cloned in to different expression vectors for kinds of research. But the vast major traits and functions can not be achieved by only one gene or one protein. They always need many genes to work together. The strategy of multigene cooperative expression is significant in many fields. Polycistron exprssion is one way of realizing this strategy. The construction of polycistron expression vector and research on exogenous gene expression efficiency affected by different spacers of polycistrons in prokaryotes will be important to study on multigene cooperative expression. However, the quantitative analysis of foreign gene expression level affected by prokaryotes spacers has not been reported.This study intends to analyse the spacer sequences of polycistrons of genome in E. coli. A series of recombinant plasmids with a bicistron of green fluorescent protein (GFP) and GAL were constructed in E. coli, including bicistron expression plasmid pET28a-lacZ-gfpD (no spacer between gfp and lacZ), pET28a-lacZ-gfpL (the star codon of gfp overlaps the stop codon of lacZ), pET28a-lacZ-gfpR (gfp and lacZ are fused), pET28a-lacZ-gfp15 (spacer is the sequence between RBS and the start codon of pET-28a), and pET28a-lacZ-gfp51(spacer is the crude one between lacZ and lacY, TAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATG). Control plasmids pET28a-gfp and pET28a-lacZ were also constructed. These recombinant plasmids were transformed into BL21(DE3), and IPTG were used to induced to genes expression. The results show that not only the second cistron gfp is effected by the spacer sequences, but also the first cistron lacZ expression level is changed due to the different spacer sequences. Whether this rule can be used in other vectors is unclear, at least, we can learn something from this experiment. |