| Wheat yellow (stripe) rust, caused by Puccinia striiformis f.sp. tritici, is one of the most important diseases of wheat. The current strategy for management of the disease is use of resistant cultivars. However, the resistance breakdown of wheat cultivars results in epidemic of the disease. It is clear that virulence mutant is major reason of resistance breakdown of wheat cultivars. Because the virulence analysis of P. striiformis f.sp. tritici is short of genetic markers , and hampered the further research to population evolution and virulence mutant of P. striiformis f.sp. tritici, and the population bioresearch of P. striiformis f.sp. tritici has been restricted. Up to date, reference about molecular markers related to virulence genes of P. striiformis f.sp. tritici has not been found. Therefore, it is very important and useful in theory and in practice to fins some specific markers related to striiformis f.sp. tritici.This paper is planning to open out the genetic diversity of pathotype Shuiyuan11 and pathotype Hybrid46 of P. striiformis f.sp. tritici using RAPD molecular marker technique. In order to clarify the virulence evolutional mechanism of P. striiformis f.sp. tritici , and to search after effective control method of wheat rust disease, and to establish a practical molecular identification system of P. striiformis f.sp. tritici, specific molecular markers of two pathotypes were searched on a large scale. The results obtained as follows:1. An optimized RAPD analysis system for the pathogen was developed in this paper, which including: 10×Reaction PCR Buffer 2.5 μl, MgCl2 2.0 mmol/L, dNTPs 0.15 mmol/L, Primer 20 ng, DNA template 40 ng, Taq DNA polymerase 1U, add double distilled water up to 25 μl in the end. Amplification program: 5 min at 94℃ for initial denaturation, then 45 cycles that consisted of 30s at 94℃,40s at 36℃ and 90s at 72℃, followed by a final 7 min extension at 72℃.2. A total of 140 random primers analyzed in this paper. The RAPD analysis was conducted to find polymorphic fragments related to the virulence genes of pathotype Hybrid46 and pathotype Shuiyuan11 from five isolations of pathotype Hybrid46 and eight isolations of pathotype Shuiyuan11. Three specific markers were found, named by HY-T1, Su-T1 and Su-T2 respectively, thereinto, HY-T1 was probably related to the virulence gene virulence of pathotype Hybrid46 , and Su-T1,Su-T2 were that of pathotype Shuiyuan11. These three reproducible fragments were cloned into the pGEM-T easy vector. Three DNA sequences of showed that the length of HY-T1 was 1052 bp, that of Su-T1 was 554 bp, and that of Su-T2 was 818 bp. The results of homology analysis showed that one hundred percent alignment homology between 926-947 nucleotide in HY-T1 and 43356-43335 nucleotide of human receptor protein; that of between 336-357 nucleotide in Su-T1 and 47975-47996 nucleotide of human receptor protein; and that of between 261-283 nucleotide, and between 15-37 nucleotide in Su-T2 and 98-120 nucleotide in Ascochyta rabiei. Its significance should be studied furthmore.3. The sequences of rDNA internal transcribed spacer (ITS) of Puccinia striiformis f.sp. tritici(PST), P. graminis f.sp. tritici (PGT) and P. recondita f.sp. tritici (PRT) were amplified by PCR using universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) , and were cloned , and were sequenced. The alignment of these pathogens tested and another pathogen from NCBI(registered No. AY114292)showed that great interspecific variation in rDNA ITS1-5.8s-ITS2 sequence region. Phylogenetic tree was obtained. Sequences of ITS regions of the ribosomal gene repeat were used to design and to synthesize primers specific for PST detection by a polymerase chain reaction (PCR). A about 170 bp product of PCR was obtained and used to detect PST among these pathogens., which could be used to develop a rapid PCR-based diagnose test to wheat yellow rust disease at early stage of P. sfriiformis f.sp. tritici infesting wheat, and could be applied for inspection and forecast.
|
PDF Full Text Request