| Watermelon (Melon) gummy stem blight, watermelon wilt, watermelon anthracnose, strawberry anthracnose and tomato gray mould are the important diseases in China, which are caused by Didymella bryoniae, Fusarium oxysporumf. sp. cucumerirum, Collecttrichum orbiculare, C. gloeosporioides and Botrytis cinerea, respectively. Great loss happened while these disease occurred severely, apparently lowering the yield and quality of the crops. Misdiagnosis of plant disease often results in the mistake of making strategy of control. It is necessary to strengthen research of rapid, accurate diagnostic techniques.PCR techniques were developed for specifically detecting the five kinds of plant pathogenic fungi. The main results are as follows1. The pathmycetes isolated from the typical diseases samples were purified and identified as Didymella bryoniae, Fusarium oxysporum f.sp. cucumerirum, Collecttrichum orbiculare, C. gloeosporioides and Botrytis cinerea through morphological diagnosis. Four methods of exacting plant and fungus genomic DNA were compared and the urea method was the best for the exaction of plant pathogenic genomic DNA.2. The internal transcribed spacer region (ITS) of the nuclear ribosomal DNA (rDNA) of five kinds of pathogenic fungi were successfully amplified with universal primers ITS4 and ITS5 and the DNA fragments of PCR varied from 500 bp to 600bp .3. All the PCR fragments of five pathogens were ligated into pGEM-T-Easy vector and then sequenced. Via nucleotide-nucleotide BLAST (blastn) searches, they were further identified to the same pathogen species as identified by morphological diagnosis. Meantimes, the ITS sequences of other homologous pathogens were collected. ITS sequence of the object pathogen was compared with ones of its closely related species and other fungal pathogens from the same host, and the mismatched region of the sequence were selected for designing the primers with Primer Premier 5.0 software. Several candidate primers for each pathogen were obtained.4. Specificity of the candidate primer was on the object pathogen, the closely speices, other pathogens from the same host and its host. One kind of specificprimer for each pathogen was obtained and its PCR condition was also optimized.For D. bryoniae, Primers were XM-2 (5' GCCTGCCATCTCTTACCCAT 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') and optimized PCR parameters as one cycle of denaturation at 94℃ for 3 min, 30 cycles of 1 min denaturation at 94℃, 30s annealing at 60℃, and 1 min extension at 72℃, followed by 20 min 72℃ extension. For C. orbiculare, Primers were XT-3 (5'TCCCCCCCCGGG CCCGCTC 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') and optimized PCR parameters as one cycle of denaturation at 94℃ for 3 min, 30 cycles of 1 min denaturation at 94℃, 30s annealing at 65℃, and 1 min extension at 72℃, followed by 20 min 72℃ extension. For F. oxysporum Schl. f.sp .cucumerirum, Primers were XK-1(5' TGGGACTCGCGTTAATTCG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3')and optimized PCR parameters as one cycle of denaturation at 94℃ for 3 min, 30 cycles of 1 min denaturation at 94℃, 30s annealing at 58℃, and 1 min extension at 72℃, followed by 20 min 72℃ extension. For C. gloeosporioides, Primers were CT-1 (5' GGCCTCCCGCCTCC GGGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') and optimized PCR parameters as one cycle of denaturation at 94℃ for 3 min, 30 cycles of 1 min denaturation at 94℃, 2 min annealing at 59℃, and 2 min extension at 72℃, followed by 20 min 72℃ extension. For B. cinerea Pers, Primers were B01-3 (5' GCCTTGTATGCTCGCCAG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') and optimized PCR parameters as one cycle of denaturation at 94℃ for 3 min, 30 cycles of 1 min denaturation at 94℃, 30s annealing at 65℃, and 1 min extension at 72℃ , followed by 20 min 72℃ extension.5. Sensitivity of PCR assay for the object pathogen was tested. For D. bryoniae, Colletotrichum orbiculare, Fusarium oxysporum Schl.f sp .cucumeri rum.,its PCR assay can detect the lowest 40f g of genomic DNA. For Colletotrichum gloe...
|
PDF Full Text Request