Lack Of Association Between A 27-bp Repeat Polymorphism In Intron 4 Of The Endothelial Nitric Oxide Synthase Gene And T

Background:Nitric oxide(NO) synthesized by endothelial NO synthase plays a key in vascular regulation and atherosclerosis. Studies suggest the basal release of NO by the endothelium contributes to basal vascular tone and regulates blood flow and blood pressure. NO also inhibits the proliferation of smooth muscle cell. Furthermore, NO protects against platelet aggregation and inhibits platelet adhesion to vascular endothelium. In addition, NO inhibits leukocyte adhesion to endothelium. All of these processes are important events during atherogenesis. Dysfunction of this important mechanism may promote atherosclerosis. Thus, the eNOS gene is considered to be animportant gene for CHD. several studies have reported polymorphisms of the eNOS gene are associated with cardiaovascular diseases. Among the reported polymorphisms of the eNOS gene, a significant association of the 4b/a polymorphism in intron 4 of the eNOS gene with hypertension and brain infarction have been reported, still the relationship between the 4b/a polymorphism and CHD in Chinese population remains to be established. Objective:To determine whether the eNOS4b/a gene polymorphism is associated with coronary heart disease in Chinese population. Methods:1. Patients and controlsWe conducted a case-control study of 154 patients with CHD and 150 healthy gender and age matched control subjects. All patients were selected from the department of cardiology, and all cases underwent coronary angiography. The diagnosis of CHD was defined according to the 1979 WHO criteria for ischemic heart disease. The controls were selected from subjects in outpatient department who underwent regular check-up examination. The controls had no history of CHD, had normal electrocardiograms.2. Determination of eNOS 4b/a polymorphismDNA was extracted from white cells, and stored at -20℃. eNOS4b/a genotypes were determined by the polymerase chain reaction(PCR) with oligonucleotide primers (sense, 5'AGGCCCTATGGTAGTGCCTT3' antisense 5'TCTCTTAGTGCTGTGGTCAC3') that flank the region of the 27-bp direct repeat in intron 4 as described by Wang, with minormodifications. PCR products were separated by electrophoresis in 6% nondenaturing polyacrylamide gel. Fragment were visualized under ultraviolet light after EB staining. Two alleles were found: A 420-bp band indicated five repeats of the 27-bp (b allele), and a 393-bp band indicated four repeats of the 27-bp . Statistical analysis:Genotype and allele frequencies were estimated by the gene-counting method and compared using the x2 analysis. Hardy-weinberg equilibrium was confirmed with the x2test. All statistical analysis were performed with SPSS 10.00 software. Results:The frequencies of the genotypes were 0.840^ 0.160 in the controls, Q.817, 0.123 in patients with CHD, and 0.875, 0.125 in patients with myocardial infarction for the eNOS4b/b eNOS4b/a+4a/a genotypes, respectively. No significant difference was found. Neither the eNOS4a allele nor the eNOS4a/a genotype conferred an independent risk factor for CHD in subgroups, e.g. individuals with myocardial infarction and individuals with multi-diseased vessels. ConclusionsWe failed to find a significant association between eNOS4a allele and CHD in the studied population. Our findings don't support the eNOS4a allele to be a risk factor for coronary heart disease in Chinese population. In addition, the severity of CHD is not associated with the eNOS4a allele.