ObjectiveOveractive bladder is the usual cause of symptom of the lower urinary tract. Clinical situation is urinary frequency,urgency of urination and urge incontinence. There is much evidence indicating that the B -AR contribute to well compliance of urine storage by relaxing the detrusor muscle. There are heated debates on Which subtype perform the cardinal function. To further investigate the function of B - AR subtype , we intend to construct B2-AR gene antisense eukaryotic expression vector using the antisense technology and block two kinds of receptor subtypes of B-AR protein and obtain the cell clone of single receptor subtype. Through further research we can certify the effect of detrusor relaxation and proliferation via activation of B - AR and find the treatment method of overavtive bladder finally.Methods1.Clone of B2- AR full length cDNA of human bladder detrusor: All procedures were carried out according to the instructions of takara biotechnology Co,. Ltd. Total RNA was extracted from human detrusor smooth muscle using Trizol. The content and integrity of RNA were identified by electrophoresis of 1% LO3 agarose gels. Two pairs of primers for B2 - AR were designed in base on a DNA sequence of Genebank(NM000024) , internal primer and external primer.Internal primer;upstream primer;5' -CCGGATCCATCGATATGGGGCAACCCGGGAACGG -3 BamHI ClaIdownstream primer: 5' - AGGAAGCTTTACAGCAGTGAGTCATITG - 3' HindIIIExternal primer:upstream primer:5' -TGCGCTTACCTGCCAGACTG - 3'downstream primer:5' - GCCCTTCCTTCTGCATATCTC - 3'The internal primer is base on protein CDS. There were BamHI and Clal restriction enzyme sites in the upstream of primer, and the HindHI in the downsteam of primer through which objective gene can be subcloned into MCS of retroviral vector pLNCX in the antisense ori-ention. 194 - 1587bp of B - AR cDNA was amplified by external primer R02. The primer was synthesized by the takara biotechnology Co, Ltd. The RT - PCR was carried out using RNA LA PCR it. cDNA synthesis is performed by 1 cycle of temperature ( 30℃ 10min, 42℃ 45min,98℃ min) and the cDNA was amplified by 35 cycles of temperature 94℃ 1min,98℃ 10s,55℃ 30s,72℃ 1 15s). A portion (8ul ) of PCR products were visualized by electrophoresis of 1% LO3 agarose gels. Image analysis was performed by BIO - RAD Flus.2.The construction of b2 - AR gene antisense eukaryotic expression vector : PCR products were purified by 1%. LO3 agarose gels, and extracted by Gel Extraction Kit. The extraction products and clone vector pUC18 were digested by BamHI and HindIII. DNA ligations were performed by objective DNA fragments with linearized cloning vector pUC18 in the presence of buffer and T4 DNA ligase. For transformation A portion of Ligation products were added into competent cell(E. coli JM109) and the transformation mixture was poured ontothe surface of an agar plate where the lac operon inducer homologue, IPTG, and the b - galactosidase chromogenic substrate, x - gal was added. After the top agar solidified, the plates are inverted and incubated overnight at 37℃. White colony was labled and dipped into a PCR tube by a fresh toothpick, and positive combination clones were i-dentified by colony PCR. The colony containing of combination clone were picked into TB culture media and were incubated overnight at 37℃ , and the combination plasmid was extracted by plasmid extraction Kit. A portion of Ligation products were identified by BamHI and Hin-dIII restriction endonuclease and was named pUC - B2 - AR. Other portion of Ligation products was digested with Clal and HindIII, and 1. 2kb target gene was recovered by 1% LO3'agarose gels. Retroviral expression vector pLNCX was digested with Clal and Hindlll and linearized vector fragment was extracted by QiAquick Gel Extraction Kit. Objective gene and vector fragment were ligated by T4 DNA ligase. After amplification the combination clone was identified by Clal and Hindlll restriction endonuclease. Base sequence and direction of insert fragment was confi...
|