Font Size: a A A

Screening For Novel Metastasis-related Genes In Small Cell Lung Cancer Using MRNA Fluoro-Differential Display

Posted on:2006-05-18Degree:MasterType:Thesis
Country:ChinaCandidate:M J LiFull Text:PDF
GTID:2144360152496777Subject:Surgery
Abstract/Summary:
PrefaceThe incidence of malignant tumor has dramatically increased in recent years, due in part to the development of industrialization, circumstance pollution and the changes of life style. Malignant tumor has become one of the major causes of mainkinds death. It has been reported by Parkin that more than 20 million patients have malignant tumor in the world and approximately ten million new cases are diagnosed each year, seven million dead each year. Anderson RN said that malignant tumor accounts for 28% in all causes of death, ranked as second, in National Vital Statistics Reports 2003。 In a word, malignant tumor is a common ailment with high morbidity and mortality rates and we must pay more attention to tackle it.Tumor is an abnormal growth of local tissue resulting from uncontrolled multiplication of cells on gene level under kinds of causes. Infiltration and metastasis are the most important biological characteristics of malignant tumor. The research of modern molecular biology has already announced that metastasis is a complicated multiple - step course in which many special genes are involved. Include activating of metastatic gene and inactivating of metastatic suppressor and their interaction. We may cure malignant tumor if we could find real effective target gene for gene therapy. Nowadays, many metastasis - related genes have been identified, such as nm23, BRMS1, PTEN, Drg -1, MAPKK4, Raf kinase inhibitor Rkip, Kiss -1 etc. Some of them are already under clinic trial. However, there are no effective gene are found which can be used easily and widely. Therefore, screening for metastasis - related genes has become one ofthe hotspots in modern tumor molecule biology.We combined mRNA - differential display ( DD) and laser capture micro-dissection (LCM) technique to search for new target metastasis - related genes.ObjectFluoro — differential display and LCM are employed to clone and identify new metastasis - related genes in small cell lung cancer (SCLC) and its corresponding metastatic lymph node.Materials1. Samples: 15 fresh samples are frozen in liquid nitrogen embedded with OCT media right after resection. SCLC was confirmed by experienced patholo-gists.2. Main reagents; (1) total RNA extraction: Trizol Reagent(GIBCOBRL company) ; (2) RT - PCR Kits: Superscript? III First - Strand Synthesis System for RT-PCR ( INVITORGEN company) ; (3) DD kits: Genomyx Fluoro-differential display kits(BECKMAN company) ; (4) PCR kit: TaKaRa EX TAQ kits (TAKARA company) ; (5) Clone reagent; TaKaRa pMD 18 -T Vector (TAKARA company).3. Main instruments; (1) Pixcell II Laser capture microdissection( ARC-TURUS company); (2) Gene Amp PCR System. (PERKIN - ELMER) ; (3) GenomyxLR DNA Sequencer Electrophoresis System (Gx100), GenomyxLR? Fluorescent Imaging Scanner (FL100 - 4) ( BECKMAN company); (4) ABI PRISM 310 Genetic Analyzer (APPLIED BIOSYSSTEMS).Method1. The procurement of pure cancer cell: The Arcturus PixCell II system was employed to procure pure cells from fresh - frozen samples of SCLC and corresponding metastatic lymph nodes.2. The extraction of total RNA: Total RNA extraction was performed using Trizol reagent (INVITORGEN) according the manufacturer's specification from LCM - captured pure cells. Then the RNA was eluted and digested with RNase- free DNase I to rid genomic DNA contamination. Measure OD260 and OD280 value to calculate RNA concentration and purity. The RNA sample should be stored in RNase -free water at -80^ for later use.3. The synthesis and amplification of cDNA: first -strand cDNA synthesis is performed with two of the twelve T7(dT12) AP anchored primers respectively at 25℃. for 5min,50℃ for50min and 85℃ for 5min. PCR amplifications were carried out with one TMR - anchored fluorescent primer and one arbitrary primer at for4min, then 5 cycles of 95℃ for 15sec, 50℃ for 30sec ,and 35 cycles 95℃ for 15sec, 60℃ for 30sec, and finally72℃ for 7min.4. DD PAGE: Electrophoresis was done on the GenomyxLR? DNA Sequencer Electrophoresis System at 55 ℃, 3000 V, and 100 W for 5 h in a HR -1000 5.6% denaturing polyacrylamide gel. After scanning the gel on the GenomyxLR? Fluorescent Imaging Scanner, differential displayed bands were excised from the gels, and gel pieces were immersed in 50μl Tris/EDTA( 10mM Tris -Cl, 1mM EDTA). They were then incubated at 37 ℃ for 1h and stored at -20℃ for further use. Gel bands reamplification was done with M13 reverse ( -48) 24 - mer premer (5' - AGCGGATAACAATTTCACACAGGA - 3' and T7 promoter 22 -mer premer (5' - GTAATACGACTCACTATAGGG C - 3' ) according the manufacturer' s specification ( BECKMAN).5. Purification the reamplified gene fragments was carried out using Takara Agarose Gel DNA Purification Kit as its instruments.6. Cloning: The purified gene fragments were ligated into pMD 18 -T Vector (TaKaRa company) , then transformed into JM109 competent cells following manufacturer's instrument. PCR was performed to check the clone result.7. Gene fragments sequencing and BLAST: The cloning products were se-quenced by United Gene Institute with ABI PRISM 310 Gentic Analyzer. The sequence data was submitted to GenBank to compare the homology with BLAST.8. RT - PCR and confirmation of differential mRNA expression. We extracted total RNA from 15 fresh — frozen SCLC sample and its corresponding meta-static lymph nodes, then performed RT — PCR to confirm the express differences of EST L1. Statistic analyses were performed at last.Result1. Differential expression of SCLC and its corresponding metastatic lymph nodes. We got 24 differential expressed bands (express sequence tags, ESTs). Three were cloned and sequenced, named as L1, L2, and C1 respectively. EST L1, L2 are found in metastatic lymph nodes and are negative in SCLC; EST C1 is found in SCLC and negative in metastatic lymph nodes.2. Cloning, sequencing and sequence alignment analysis of differential expressed gene fragments. BLAST results shows that EST Lt (357bp) , EST L2 (419bp) and EST C1(296bp). Sequence alignment reveals that EST L1 has a sequence homology with Homo sapiens BAC clone RP11 - 31 E13 ( chromosome 10q22. 3 - 10q23.1) with score 609bits , Expt = e -171 and identities 99% ; EST L1 also has a sequence homology with Homo sapiens PAC clone RP11 -259A6 (chromosome 10q22.3) with score 609bits , Expt = e-171 and identities 99%. EST L2 has a sequence homology with Homo sapiens BAC clone GS1 - 96J14 (chromosome 7q15. 3} with score 737 bits, expect = 0.0 and identities = 100%. EST L2 also has a sequence homology with Homo sapiens ATP - binding cassette sub - family E member 1 (ABCE1) (chromosome 4q21) , with score = 581 bits, Expect = e-163 and identities 95% . EST C1 has a sequence homology with Homo sapiens BAC clone RP11 -758114 (chromosome 3q) with score 609bits, Expt = e-134 and identities 100%. The functions of BAC clone RP11 -31E13, GS1 -96J14, RP11 -758114 and PAC clone RPll -259A6 remain unknown now.3 RT - PCR and statistic analysis EST L1 is positive in 12 of 15 metastatic lymph nodes, the positive rate is 80%. In its origin of lung cancer, EST L1 is positive in 5 of 15, the positive rate is 33.33%. There were a statistically significant differences when comparing the express difference results by use of the kappa statistic analysis (P < 0.05).
Keywords/Search Tags:Small cell lung carcinoma ( SCLC), Metastasis related genes, mRNA Differential display, Laser capture microdissection ( LCM)
Related items