| Fas/Fasl are apoptosis-induce gene, in the central nerve system, they are considered to be related with happening and growing of glioma. Glioma was the most common malignant tumor in brain. Despite of all the therapeutic measures such as operation, radiotherapy and chemotherapy, patients suffered from glioma died several months after diagnosis. Researches of gene therapy are carried out world wide. As to glioma, gene therapy including enzyme/ prodrug therapy, immune gene therapy, therapy aimed at multiplication, differentiation and apoptosis of tumor, and antiangiogenesis drug, et al. Fas is a important gene which aims to apoptosis path of tumor. Fas gene and it's ligand, called FasL, can spread death signal to cells. The Fas receptor is a transmembrane protein of 43 kDa molecular weight. Binding of FasL leads to Fas activation and the induction of intracellular signals that result in apoptosis cell death. Fas gene can be detected in the glioma tissue, what give us a clue of body immune against the tumor, as well as provid a new way to cure this illness. It can be assumed that lacking of Fas protein on the surface of cell was one of the reasons that cause tumor. So we can deduce that inserting Fas gene into glioma cells could induce them to express Fas protein, hence apoptosis would happen. As reported, Fas gene combined with chemotherapy worked well on sensitive glioma cells. Other researchesshowed that some gene (such as IFN-p* gene) can induce apoptosis in glioma cells by up-regulate Fas gene expression?.Fas gene can induce tumor apoptosis, the premise is that the gene can be transfected into tumor cells safely and efficiently. As the basic research, cloning and eukaryotic expression vector constructing of Fas gene is a important and urgency task. More deeper researches, such as resistance to Fas-induced apoptosis, and co-expression of several genes in glioma cells(910), require more work on it. Our research answered to this demand.Research about the relationship between Fas gene and glioma began 6 years ago and went further in the last 3 years. Cloning and eukaryotic expression vector constructing of gene, comparatively, fall behind the basic research. HU Zhong-bo reported he had cloned and expressed a murine soluble Fas gene from immature mouse's thymocyte(U), which lacked transmembrane region. It expressed a dissociated protein which combined the Fas ligand and inhibit the inducement of apoptasis, kept cells from death. But from that on, there was no report about the cloning and constructing of Fas gene, cloning of full sequence of rat's Fas gene remained vacancy in our nation. After several months of work, we cloned the whole Fas gene from rat and constructed a series of eukaryotic expression vectors. It will be appreciated if our work could provide proper eukaryotic expression vectors for different requirement. This is a foundation for us to acquaintance expression disciplinarian and effecting base of Fas gene. We hope our experiment can provide some help for finding new way to kill glioma cells and advence the therapy of this malignant tumor.Materials and methods1. Main reagent: Trizol, Access RT-PCR System, eukaryotic expression vectors: PLXSN> PIRES2 and PcDNA, restriction endonuclease, PCR kit, PUCm-T vector, gel-purification recovery kit, vector extraction kit, et al. The primer construction andsequence identification was executed by shanghai Sangon biological engineering & technology and service Co.Ltd .2. Primer design Based on GeneBank data, asisted by Primer design software DNAstar, we design the primer as follow:Up-stream primer: 5'- CCGAGAATTCTGCAGATATGCTGTGGAT -3;Down-stream primer: 5'- GAGACTCGAGTTTTCACTCCAGACTTTG -3?3. Abstraction of total RNA and cloning of target gene: Obtain rat thymus gland tissue, milled and suspended it. Abstract total RNA with Trizol. Followed the Access RT-PCT system procedure strictly, cDNA was obtained from reverse transcription of total RNA. We amplified target gene through PCR technique, led by the primer that designed before , with the RT product as template. The DNA sequence was identified by dideoxy chain termination method to ensure that was the gene we wanted.4. Construction of eukaryotic expression vectors Identified Fas gene was digested by restriction endonuclease EcoR I and Xho I and inserted into eukaryotic expression vectors, PLXS^PIRES2 and PcDNA. The product named as: PLXSN-Fas^ PIRES2-Fas ans PcDNA-Fas.Results1. The extraction product was examed by gel electrophoresis, the strip of 18S and 28S was evident under ultraviolet lamp,.2. The product of PCR was examed by gel electrophoresis, there was specific strip around lkb DNA marker strip. Which match to anticipated molecular weight of Fas.3. Sequence identification was executed by shanghai Sangon biological engineering & technology and service Co.Ltd . The result confirmed that our product was the Fas gene.4. PLXSN-Fas, PIRES2-Fas and PcDNA-Fas were digested by restrictionendonuclease EcoR I and Xho I respectively, the specific strip around lkb and 5kb DNA marker strip can be seen, ascertained that eukaryotic expression vectors were successfully constructed.ConclusionsRT-PCR technique is one of mature and basic method to obtain gene in vitro. With carefully primer designing and strictly operating, we cloned rat's Fas gene successfully. After repeatedly confirming by endonuclease digestion appraisement and sequence identification, we assured that the Fas gene was what we wanted. Illuminated that we are able to clone Fas gene under the present conditions. We also provided technique basement for cytology experiments of rat's Fas gene and similar experiment for human being.The PUCm-T-Fas vector that We consructed, which was clone-vector, can not be transfered directly into cells to induce expression. In order to continue the research, we must construct express vectors. We inserted Fas gene into PLXSN, PIRES2 and PcDNA to construct a series of eukaryotic expression vectors, provided base for further research. |