ShRNA Aiming At Glycosyltransferases Inhibit Invasive And Proliferative Ability Of LoVo Cell Line Both In Vitro And In Vivo

Background:Most protein in organism exist in the form of glycoprotein,sugar chains of glycoprotein affect its functions directly.It is known that sugar chains have a variety of functions and play a key role in growth,development,differentiation and adhesion in cells.Structural changes in N-glycans are one of the critical steps in cellular malignant transformation.It is well known that the structures of complex carbohydrates are altered in cancer and that these changes are highly associated with invasion and metastasis.The mechanism by which those changes occur are still unknown,but in most cases the activation of glycosyltransferases plays a major role and this leads to so-called 'aberrant glycosylation' in cancer tissues.N-Acetylglucosaminyltransferasesâ…¤(GnT-â…¤) play a pivotal role in the processing of N-linked glycoproteins,and are highly involved in cancer progression and metastasis.GnT-V catalyzes the formation of GlcNAc-β1-6 branches at the Manα1-6 side of the trimannosyl core of N-glycans.These branches are abundant in cancer tissues,especially in those with high metastatic potential.RNA interference(RNAi) is a sequence-specific post-transcriptional gene silencing in widespread organisms triggered by double-stranded RNA(dsRNA), which is homologous with target gene sequence.In the RNAi pathway,long dsRNA is cleaved into about 21-25nt small interfering RNA(siRNA) through the action of Dicer,a cellular ribonucleaseâ…¢.These siRNAs become associated with a complex of proteins to form the RNA-induced silencing complex(RISC),which leads to homologous target mRNA destruction.Thereby,the target gene expression is blocked in post-transcription.At present,few studies refer to the relationship of GnT-â…¤and colorectal cancer, RNA interference adopting has not yet been reported.So we adopted RNA interference to inhibit the expression of GnT-â…¤for the first time,constructed expression vectors of small haired RNA aimed at N-acetylglucosaminyltransferaseâ…¤(GnT-â…¤) gene,which was higly expressed in colorectal cancer.Then transfected these vectors into high metastatic potential LoVo cell line,investigated effects of GnT-V expression on proliferation and metastasis of LoVo cell line.By this way,it can offer objective proof to identify new target in molecule-targeting treatment of colorectal cancer.Objective:To construct expression vectors of small haired RNA aimed at GnT-â…¤gene, which was higly expressed in colorectal cancer,and to investigate effects of GnT-â…¤shRNA on proliferation,adhesion,migration and invasion of high metastatic potential LoVo cell line.By this way,it can offer objective proof to identify new target in molecule-targeting treatment of colorectal cancer.Methods:1,Construction and identification of pGPU6/GFP/Neo GnT-â…¤shRNA(1) GnT-â…¤siRNA sequence design:According to siRNA design principle,using "siRNA Target Finder and Design Tools" of Ambion company,we designed two RNA fragments aiming at GnT-â…¤cDNA(NM₀02410.3).sequence information as follows:sense 5′GGAAGTGCATGCAACTGTTTA 3′,sense 5′CTCCTTT GACCCTAAGAAT 3′,naming them GnT-â…¤/1564 and GnT-â…¤/2224 respectively. To design a negative control siRNA,scramble the nucleotide sequence of the gene-specific siRNA and conduct a Blast contrast to make sure it lacks more than 70 %homology to any other gene.Negative control sequence information as follows: sense 5′GTTCTCCGAACGTGTCACGT 3′,naming it GnT-â…¤/NC.(2) shRNA transcriptional template DNA design:According to designed siRNA sequence,we designed template DNA oligonucleotides,the order of sequence as follows:Bbsâ… restriction site,sense sequence,9nt loop sequence,antisense sequence,RNA polymeraseâ…¢termination(6 nucleotide poly T),BamHâ… restriction site.(3) Construction and identification of pGPU6/GFP/Neo GnT-â…¤plasmid:To construct recombinant plasmid,we annealed the two siRNA template oligonucleotides of each group,and ligated annealed siRNA template insert into pGPU6/GFP/Neo,then transformed E.coli DH5αwith the recombinant plasmid, picked Kanamycin resistant colonies and isolated plasmid DNA,digested the plasmid with Bbsâ… and BamHâ… ,sequenced with U6 primers to verify that the clone contains the insert,and that it is the desired sequence.Then expanded colonies, extracted and purified pGPU6/GFP/Neo GnT-â…¤plasmid for transfection.2,Cell culture and transfectionHuman colorectal cancer cell line LoVo was cultured in RPMI-1640 containing 10%newborn cow serum,in the condition of 37℃5%CO₂.When LoVo cells were cultured to exponential growth phase,Lipofectamine 2000^TM was used to transfect recombinant plasmids into LoVo cells.Stable transfectants were selected in RPMI-1640 containing G418 at 500μg/mL.3,Examination of interfered effects(1) The mRNA expression of GnT-â…¤were measured by semi-quantitative reverse transcription polymerase chain reaction(RT-PCR).Total RNA was isolated from cells and converted into cDNA by using hexamer random primers. N-Acetylglucosaminyltransferaseâ…¤cDNA was amplified by using the primers 5′ AACTCTTGGACCATCCTGGGTTC 3′and 5′TTGCTGCTTTTGGGTGGGTT 3′,which generated 555bp products.To normalize the efficiency of the amplification,β-actin cDNA was amplified by using the primers 5′GAAACTACCTTCAA CTCCATC 3′and 5′CGAGGCCAGGATGGAGCCGCC 3′,which generated 219bp products.They were amplified by 36 cycles of 94℃for 30 s,60℃for 30 s and 72℃for 30 s.(2) The protein expression of GnT-â…¤were measured by Western blot analysis. Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinyldifluoride(PVDF) membranes.The blots were blocked with 5%defatted milk for 1h at room temperature and then probed with goat anti-human antibodies against GnT-â…¤(1:200) and mouse anti-human antibodies against GAPDH(1:1000) for 1h at room temperature,respectively.After three washes,the blots were subsequently incubated with rabbit anti-goat peroxidase-conjugated secondary antibody(1:500) and rabbit anti-mouse peroxidase-conjugated secondary antibody(1:5000) for 1h at room temperature,respectively.The blots were visualized by enhanced chemiluminescence using Fuji super RX film(Fuji film,Tokyo,Japan).4,The effects of pGPU6/GFP/Neo GnT-â…¤shRNA vectors on proliferation, adhesion,migration and invasion of LoVo cell line(1)Cell proliferation was evaluated by CCK-8 assay:Cells were cultured to exponential growth phase,CCK-8 assay was used to analyze cell activity at different times(0h,24h,48h,72h,96h),eight replicates were measured at each time.Cell growth curves were portrayed by using OD450nm value of each group,and calculated growth inhibitory rate of interfered group.Cell growth inhibitory rate(IR)=(OD450 value of negative control group—OD450 value of interfered group)/OD450 value of negative control group×100%.(2) Heterogenous adhesionCells were cultured to exponential growth phase,each group set up 24 replicates. Cells were cultured in the absence of newborn cow serum for 24 hours.Microtiter plates with 96 wells(Coring) were coated with Matrigel gel(50μL/well).The wells were subsequently washed twice with PBS solution,and then blocked with 1%BSA (Sigma)/PBS at 37℃for 2 h.Cells were detached from culture dishes by dissociation buffer,seeded at a density of 5×10³ cells/well in 100μL of medium,and then incubated at 37℃for 1h.The assay was terminated by washing with PBS to remove unbound cells.The attached cells were measured with CCK-8 assay.(3) Chemotactic migrationThe inhibitory effect of RNAi on migration and invasion of LoVo cells in vitro was assayed using 24-well Transwell cell culture chambers(6.5 mm diameter,8.0μm pore size,polycarbonate membrane,Corning).Cells were cultured in the absence of newborn cow serum for 24 hours.10%newborn cow serum was chosen as chemotactic factor.Results are shown as the number of cells that had migrated through the polycarbonate membranes by counting 5 randomly chosen HPF under light microscopy(400×) for each replicate.(4) Wound closure assayCells of exponential growth phase were plated onto Collagenâ…£coated wells, and were cultured to grow to monolayer.Linear scrape wounds were made on the cell monolayers,and cultured in the presence of 10%newborn cow serum.The wounds were allowed to heal for 36 hours.Pictures of wound heal were taken in 4 randomly chosen HPF under light microscopy for each replicate at 0h,12h,24h and 36h respectively(240×),wound cure rate=(distance of linear scrape wounds before healing—distance of linear scrape wounds after healing)/distance of linear scrape wounds before healing×100%.(5) Cell invasive experimentCells of exponential growth phase were cultured in the absence of newborn cow serum for 24 hours.24 well Transwell cell culture chambers and matrigel gel were used to examine cell invasion.The number of cells that had penetrated through the matrigel gel and polycarbonate membranes were determined by counting 5 randomly chosen HPF under light microscopy(400×) for each replicate. 5,Tumorigenicity and tumor metastasis in vivo(1) Tumorigenicity in nude miceThe experimental protocol was approved by the China Institutional Ethics Review Committee for Animal Experimentation.Cells(2.5×10⁶/mouse) suspended in 100μL RPMI-1640 were injected subcutaneously into the 6-week-old male BALB/c nude mice at the hips.The animals were sacrificed on the 21st day after injection and the tumors were dissected and weighed.(2) Tumor metastasis in nude miceGroups of mice were anesthetized with methoxyflurane and placed in the right lateral decubitus position.A transverse incision was made in the left flank through the skin and peritoneum,exposing the medial aspect of the spleen.Gentle retraction of the tail of the pancreas was used to stabilize the spleen.Separate groups of mice received 2.5×10⁶ tumor cells in 0.05 ml by injection into the medial splenic tip with a 30-gauge needle so as to raise a visible pale wheal.No significant bleeding or extravasation was encountered.The spleen was returned to the abdominal cavity,and the wound was closed in one layer with wound clips.Three weeks after the injection of tumor cells,the animals were killed by cervical dislocation,autopsies were performed,and organs were removed and placed in Bouin's solution.For analysis of metastasis,the number of macroscopically visible metastatic nodules on the surface of livers was measured.Six mice were used in each experimental group.6,StatisticsResults were analyzed by SPSS13.0 software.The values given are means±SD. Statistical analysis between two samples was performed using Student's t-test. Statistical comparisons of more than two groups were performed using one-way analysis of variance(ANOVA).In all cases,p＜0.05 was considered as significant.Results:1,Identification of recombinant plasmid Digested the recombinant plasmid pGPU6/GFP/Neo GnT-â…¤/1564,pGPU6/GFP/Neo GnT-â…¤/2224,pGPU6/GFP/Neo GnT-â…¤/NC with Bbsâ… and BamHâ… ,digestion products were checked by electrophoresis,results show that target fragment were inserted to recombinant plasmid successfully.Sequence analysis also verified the insert is the desired sequence.GnT-â…¤shRNA expression plasmid was constructed successfully.2,Stable transfection of recombinant plasmidPlasmid pGPU6/GFP/Neo contains the coding sequence of Green Fluorescent Protein gene,so stably transfected cells can emit green fluorescence by fluorescence microscopy.Fluorescence microscopy detection showed that recombinant plasmids were stably transfected to LoVo cell line successfully.3,Examination of interfered effectsThe mRNA expression of GnT-â…¤in three cell groups were evaluated by semi-quantitative RT-PCR.GnT-â…¤shRNA can reduce expression of GnT-â…¤mRNA in LoVo GnT-â…¤/1564 cells and LoVo GnT-â…¤/2224 cells,by 82%and 71.5% respectively.The protein expression of GnT-â…¤in three cell groups were analyzed by immunoblotting with anti- GnT-â…¤antibody.GnT-â…¤shRNA can down-regulate GnT-â…¤protein expression of LoVo GnT-â…¤/1564 cells and LoVo GnT-â…¤/2224 cells, by 68%and 56%respectively.The more effective interfered cell line,LoVo GnT-â…¤/1564,was chosen to do further experiment.4,Influence of GnT-â…¤shRNA expression vectors on cell proliferationCell growth curves were portrayed by using OD450nm value of different times(0h,24h,48h,72h,96h),and calculated growth inhibitory rate of LoVo GnT-â…¤/1564.CCK-8 assay showed proliferation of LoVo GnT-â…¤/1564 was inhibited obviously(P＜0.001),especially in 72h.5,Influence of GnT-â…¤shRNA expression vectors on adhesion,migration and invasionDown-regulation of GnT-â…¤expression can enhance adhesive ability(t=- 3.357,P＜0.01) and inhibit chemotactic migration(t=44.051,P＜0.001) in LoVo cell line; quantitative analysis of the wound closure assay also indicated that down-regulation of GnT-â…¤expression can significantly prolong wound heal hours of LoVo cell line; cell invasive experiment using matrigel gel showed that penetrative cell numbers of LoVo GnT-â…¤/1564 and LoVo GnT-â…¤/NC were 5.10±1.25 and 39.55±2.16 respectively,penetrative cell numbers of LoVo GnT-â…¤/1564 cell was reduced obviously,compared to negative control group cell(t=61.626,P＜0.001).6,Influence of GnT-â…¤shRNA expression vectors on cell proliferation in vivoMean weight of LoVo GnT-â…¤/NC and LoVo GnT-â…¤/1564 were(1.20±0.05)g and(0.48±0.04)g respectively,down-regulation of GnT-â…¤expression can reduce cell proliferation of LoVo cell line in vivo(t=27.528,P＜0.001).7,Influence of GnT-â…¤shRNA expression vectors on LoVo cell liver metastatic ability in vivoMean liver metastatic tuberculums of LoVo GnT-â…¤/NC and LoVo GnT-â…¤/1564 were 156.67±5.61 and 24.83±6.11 respectively.The result show that down-regulation of GnT-â…¤expression can significantly inhibit LoVo cell liver metastasis in vivo(t=38.923,P＜0.001).Conclusion:1,The shRNA expression vectors aimed at GnT-â…¤gene can down-regulate the expression of GnT-â…¤both in the level of mRNA and protein obviously.2,Down-regulation of GnT-â…¤expression can significantly inhibit proliferation, migration and invasion of LoVo cell line in vitro.3,Down-regulation of GnT-â…¤expression can significantly inhibit proliferation and liver metastasis of LoVo cell line in vivo.4,The sequence of RNA interference against GnT-â…¤may be a valid target to treat colorectal cancer.