Research On The Mechanism Of Combined HTERT RNAi And PUMA Gene On The Apoptosis Of MCF-7 Cells In Vitro

Abstract : Objectives: To construct RNA interference eukaryotic expression vectors targeted at hTERT gene and the eukaryotic expression vectors of PUMA gene. To explore the relativity of hTERT and PUMA protein expression in MCF-7 cells,and the possible mechanism of apoptosis of MCF-7 cells induced by combinated hTERT RNAi and PUMA gene ,which could provide a experimental evidence for the combination of hTERT RNAi and exotic PUMA gene expression as a new effective way of tumor gene therapy . Methods:According to the RNA interference target sequence aimed at hTERT gene GGAACACCAAGAAGTTCATCT, designed and synthesized two strands of oligonucleotides which included a hairpin structure, then the double-strand DNA was cloned into pYr-2.1-hU6 vector and the recombination expression plasmid pYr-2.1-hTERT-shRNA was constructed. After transfecting the recombinant into the susceptible cell E.coli DH5α, we choosed the positive colony which was screened by kanamycin resistance and CCDB to amplify by shaking, then extracted the plasmid. Correct sequence of hTERT RNAi was respectively identified with restriction endonuclease analysis by SacI and DNA sequencing methods. In the same way, we constructed the negative control pYr-2.1-HK that did not aim at any gene. We cloned the PUMA gene sequence (gene bank NM₀14417) into the plasmid pYr-ads-1 and constructed the recombination expression plasmid pYr-ads-1-PUMA, then transfected the susceptible cell E.coli DH5α, choosed the positive colony which was screened by kanamycin resistance to amplify by shaking, then extracted the plasmid. Correct sequence of PUMA gene was respectively identified with restriction endonuclease analysis by BamHI and EcoRI and DNA sequencing methods. We used pYr-2.1-EGFP and pYr-2.1-RFP for transfection rate. The experiment was setted up six groups, they were blank control group, hTERT negative control group, PUMA empty vector control group, pYr-2.1-hTERT-shRNA group, pYr-ads-1-PUMA group, pYr-2.1-hTERT-shRNA/pYr-ads-1-PUMA group. MCF-7 cells that were in good condition were plated in 6-well cell culture plates, then we added 10μl LipofectamineTM2000 +4μg plasmid/well except the combined group which we added 20μl LipofectamineTM2000 +8μg plasmid/well ,and then transfected the compound to the MCF-7 cells in every group, but didn't add any reagent to blank control group. At 48 hours after transfection, the total protein from each well of cells was isolated for Western blot to detect the relative expression of hTERT,PUMA,Bcl-2,Bax,Caspase-3 protein in every group. Results: 1. The recombinant plasmids pYr-2.1-hTERT- shRNA were identified by restriction endonuclease analysis with SacI and sequence analysis ,the results showed that the target sequence had inserted into the predicted site precisely and the recombining plasmids were successfully constructed. 2. The recombinant plasmids pYr-ads-1-PUMA were were identified by restriction endonuclease analysis with BamHI and EcoRI and sequence analysis ,the results showed that the target sequence had inserted into the predicted site precisely and the recombining plasmids were successfully constructed. 3. Observing the MCF-7 cells under the fluorescence microscope 48h after transfection of pYr-2.1-EGFP and pYr-2.1-RFP, transfection efficiency was about 60%. 4. The result of analysis of the western blot showed that the relative expression quantities of hTERT protein at pYr-2.1-hTERT-shRNA group and pYr-2.1-hTERT-shRNA/ pYr-ads-1-PUMA group was about 52% lower than the three control groups, 53.5% lower than pYr-ads-1-PUMA group, but the difference between pYr-2.1-hTERT-shRNA group and pYr-2.1-hTERT-shRNA /pYr-ads-1-PUMA group had no statistical significance (P>0.05), the difference between pYr-ads-1-PUMA group and the three control groups had no statistical significance (P>0.05);the relative expression quantities of PUMA protein at pYr-ads-1-PUMA group and pYr-2.1-hTERT-shRNA /pYr-ads-1-PUMA group was about 145.3% higher than the three control groups, 147.7% higher than pYr-2.1-hTERT-shRNA group, but the difference between pYr-ads-1-PUMA group and pYr-2.1- hTERT-shRNA /pYr-ads-1-PUMA group had no statistical significance (P>0.05), the difference between pYr-2.1-hTERT-shRNA group and the three control groups had no statistical significance (P>0.05); the relative expression quantities of Bcl-2 protein at pYr-2.1-hTERT-shRNA group and pYr-2.1- hTERT-shRNA/ pYr-ads-1-PUMA group was about 25.1% lower than the three control groups, 24.6% lower than pYr-ads-1-PUMA group, but the difference between pYr-2.1-hTERT-shRNA group and pYr-2.1-hTERT-shRNA /pYr-ads- 1-PUMA group had no statistical significance (P>0.05), the difference between pYr-ads-1-PUMA group and the three control groups had no statistical significance (P>0.05);the relative expression quantities of Bax protein at pYr-2.1-hTERT-shRNA group and pYr-2.1-hTERT-shRNA/pYr-ads-1-PUMA group was about 46.1% higher than the three control groups, 45.2% higher than pYr-ads-1-PUMA group,but the difference between pYr-2.1-hTERT-shRNA group and pYr-2.1-hTERT-shRNA /pYr-ads-1-PUMA group had no statistical significance (P>0.05), the difference between pYr-ads-1-PUMA group and the three control groups had no statistical significance (P>0.05);the relative expression quantities of Caspase-3 protein at pYr-2.1-hTERT-shRNA group,pYr-ads-1-PUMA group and pYr-2.1-hTERT-shRNA/ pYr-ads-1-PUMA group was lower than the three control groups, they respectively decreased by about 23%,43.3%,62.4%. Conclusions: 1. shRNA eukaryotic expression vectors aimed at hTERT and eukaryotic expression vectors of PUMA gene were successfully constructed. The former can effectively inhibited the expression of hTERT protein, the latter can effectively increase the expression of PUMA protein, but protein expression of hTERT and PUMA have no relativity. 2. hTERT RNAi decreased Bcl-2 expression and increased Bax expression, activated Caspase-3 protein. hTERT RNAi induced MCF-7 cell apoptosis by mitochonrial pathway.3. PUMA activated Caspase-3 protein and induced MCF-7 cell apoptosis by mitochonrial pathway. 4.The hTERT RNAi and PUMA gene had cooperation effect on the activation of Caspase-3 protein, that is to say, the combination of hTERT RNAi and exotic PUMA gene expression can induce MCF-7 cell apoptosis more effectively in theory.