RNA Interference STAT5A Gene Induce Apoptosis Of Human Hepatocelluar Cancer Cell

Objectives:To construct two RNAi expression vector of STAT5A gene and explore the specific inhibitory effect of this vector on STAT5 A mRNA expression and the effect of induce apoptosis of HepG2 cells, and to lay the experimental foundation for the advanced research. Methods: Designed RNA interference target sequence targeted at STAT5A gene GCTCTGAATTAGTCCTTGCTT and GCGCTTTAGTGACTCAGAAAT, then synthesize two strands of oligonucleotides including a hairpin structure. The pYr-2.1 vector was digested with Bsal, then purified and retrieved the fragment by agarose electrophoresis separation. The double-strand DNA was inserted downstream from the U6 promoter of the linear pYr-2.1 vector by T4 ligase and the recombination expression plasmid pYr-2.1-hU6-STAT5A-1 and pYr-2.1-hU6-STAT5A-2 was constructed. The next step was transfecting the recombinant into the susceptible cell E.coli DH5a which was prepared by CaCl2 method, and choosing the positive colony which was screened by kanamycin resistance and CCDB to amplify by shaking, then extracting the plasmid. To make sure the interference fragment was accurate, that is to say, the siRNA expression vector targeting STAT5A had been constructed successfully, the extracted recombinant was digested by Xhol respectively, and to analyze the result by agarose electrophoresis and DNA sequencing. At the same time, we constructed the negative control recombinant pYr-2.1-HK that did not aim at any gene by the same method.HepG2 cells that were in good condition were plated in 6-well cell culture plates 24 hours prior to transfection, and set up four experimental groups, they were blank control group, negative control group and STAT5A-1 group,STAT5A-2 group. We used pYr-2.1-EGFP that for transfection rate, and added-7.5μl LipofectamineTM 2000+3μg plasmid/well, and then transfected the compound to the HepG2 cells(do not add any reagent to blank control group). At 48 hours post transfection, the EGFP (enhancement green fluorescent protein) gene of pYr-2.1-EGFP recombinant could express, so transfection rate could be judged by observing the ratio of green fluorescence cells under the fluorescence microscope. The total RNA from each well of cells was isolated by TRIzol reagent at the same time. And the concentration, purity and integrality of total RNA were detected by GeneQuant pro RNA/DNA and agarose gel electrophoresis. The semi-quantitative two-step RT-PCR which took the total RNA as template and took GAPDH as the control was used to determine the interference efficiency. Agarose gel electrophoresis and semi-quantitative gray scale scan were used to detect the relative expression of STAT5A mRNA in every group. And the cell apoptosis was observed by means of flow cytometry FCM by FITC/PI double staining after gathered every group cells at 72h after transfection. Results:①The recombinant plasmids pYr-2.1-hU6-STAT5A-1 and pYr-2.1-hU6-STAT5A-2 were digested with Xhol to agarose gel electrophoresis and sequence analysis, showed that the target sequence had inserted into the predicted site precisely and the recombining plasmids were successfully constructed.②Observe the HepG2 cells under the fluorescence microscope 48h after transfection, and judge the transfection rate that LipofectamineTM 2000 to HepG2 cells was about 65% according to the ratio of the cells shinning green fluorescence.③The result of electrophoretic analysis of the amplification product of RT-PCR showed that the lightness of the strips of GAPDH (410bp) in the four channels were similar, while the luminosity of STAT5A-1 group,STAT5A-2 group strip (452bp) were obviously weaker compared with the other two groups. And the result of the semi-quantitative gray scale scan showed that the relative expression quantities of STAT5A mRNA in blank control group, negative control group and STAT5A-1group,STAT5A-2 group were 1.038±0.013,1.053±0.016,0.353±0.014,0.450±0.012. These data were analyzed by q test of ANOVA that the relative expression of STAT5A mRNA of STAT5A-1group,STAT5A-2 group was about 66.0% and 56.64% lower than the others groups, and the difference had statistical significance (P<0.01).But the comparation among the other two groups had no significant difference (P>0.05).④The result of analysis of flow cytometry:After transfection the STAT5A-1 group,STAT5A-2 group apoptosis rate began to increase, the rate of apoptosis is 37.33% and 33.93%. And the difference among negative control group and blank group were no statistically significant. Conclusions:①The shRNA interference sequence that had designed and synthesized had cloned to pYr-2.1 expression vector accurately, and the siRNA expression vector that aimed at STAT5A constructed successfully.②The RNAi expression vector in vivo that aimed at this target sequence efficiently and specifically inhibited the expression of STAT5A mRNA in HepG2 cells.③RNA interference STAT5A gene in HepG2 cells can induce apoptosis of human hepatocelluar cancer cell.