Identification Of Transcription Factors Binding Sites In The AOX1 Promoter Of Pichia Pastoris

The Pichia pastoris expression system has been widely used for heterologous proteins. In the methylotrophic yeast Pichia pastoris, the most commonly used promoter is AOX1 promoter, which controls the expression of the alcohol oxidase (Aox). The alcohol oxidase (Aox) in Pichia pastoris is the key enzyme in the process of methanol metabolism, and its function is to catalyze methanol oxidation to generate formaldehyde and hydrogen peroxide in peroxisome.The AOX1 promoter (PAOX1) is transcribed strong and tightly in response to methanol and repressed by other carbon sources, such as glucose, fructose or glycerol. However, the regulation mechanism of that promoter has not been explained detailedly, which needs more deeply studies.In our research, five transcription factors have been identified in Pichia pastoris by the method of homologous alignment. Two factors named Mit1 and Prm1 are activating factors related to the AOX1 promoter induced by methanol. The others are transcriptional repressors that control catabolite repression in the presence of glucose, which named Mig1, Mig2 and Nrg1. This work mainly studied the interaction between each transcription factor and the AOX1 promoter.In this study, the recombinant proteins of Mit1, Prm1, Mig1, Mig2 and Nrg1 containing the zinc finger DNA binding domains were expressed in the E.coli heterogeneously, and purified by Nickel column affinity chromatography.Because of having a lot of Cis-acting regulatory sequence elements, the AOX1 promoter was divided into 4 fragments named PAOX1-AB, BC, CD and DE. In vitro, the electrophoresis mobility shift assay (EMSA) was used for exploring the interaction between each transcription factors and 4 fragments of the AOX1 promoter individually. It is found that Mit1, Prm1 and Nrg1 are binding with different regions of the AOX1 promoter. More specifically, Mit1 is binding with fragments BC and CD of the promoter, Prm1 is binding with fragments CD and DE, and Nrgl is binding with fragment AB. Then the specific binding sites of Prm1 and Nrg1 was identified by DNase I footprinting analysis. The binding sequence of Prm1 in the AOX1 promoter is 5’AAAAGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGAC 3’. And the binding sequences of Nrgl are 5’TCCACAGG 3’,5’CACACATAAGTGCCA 3’, 5’GGAGGGG 3’and 5’TCTCCTCAACAC 3’.The identification of key DNA elements involved in AOX1 promoter recognition by Prml and Nrg1 is an important step in understanding their functions in the methanol utilization pathway in Pichia pastoris. It provided great support for the study of transcriptional regulation mechanism of AOX1 promoter, and also is useful for the further development of methanol-free induced Pichia pastoris expression system.