Studies On Detection Of Three Nosogenetic Vibrios In Food Using Liquid Chip Technology

In recent years, diseases by pathogenic bacteria have been the prominent and widest problem for food safety, different kinds of diseases have become a serious threat to human health, which caused by Vibrio are paid more and attention. now, traditional detection methods have cumbersomeness, low sensitivity and time-consuming limitations. PCR assays have been developed for detection and identification of the bacterial Pathogens. Though, PCR assays has advantage of quick speed, it has disadvantages of cumbersomeness,low-flux. So, to develop a new rapid, sensitive, multiplexed technology for Pathogens detection and identification is very necessary.Nowadays, the xMAP liquid chip technology has been used in many fields, but it is just started to be researched in China, and hasn’t obtained enough consideration. In this paper, the sequences of Vibrio cholera, Vibrio vulnificus, Vibrio alginolyticus were collected to be studied. Then, universal primers and specific probes were designed, combining with suspension array, we establish a diagnostic assay which can identify those Vibrio to make a new approach for pathogenic microorganism detection and identification.First of all, we collected these vibrios’ full genome sequences from Genbank and then use biological software (Dnaman 6.0、Primer premier 5.0) to analyze the similarity and homoloy of each vibrio. We design a pair of universal primer and special probes as follows:upstream premier is TGGCAGTCAGAGGCGATG, downstream permier is CACGTGTCCCGCCCTACTC, Vibrio cholera’s probe is CAGATAAGGCAGTAAGAGCC, Vibrio vulnificus’s probe is CTGTGAAGTCTGAGATTCCTG, Vibrio alginolyticus’s probe is AACAGCCACTTGAGTCTACGA.Then, the probes were covalently cross linked onto different carboxylated microspheres. Through a series of experiments, which influent m-PCR factors, the optimum conditions were determined to be The rection mixture consisted of 50μL:10×PCR Buffer (include MgCL2) 5μL, dNTP Mixture (each 2.5 mM) 4μL, rTaq enzyme 0.5μL, upstream premier 0.5μL downstream permier 0.5μL, DNA 0.5μL, sterilizated ddH2O 39.0μL; 95℃4min,1Cycles; 95℃30sec,55℃30sec,72℃30sec,35Cycles; 72℃7min. Hybridization conditions were optimized using liquid chip technology. Hybridization temperature is 53℃, Hybridization time is 20min.The repeatability, specificity and sensibility of the chip were also evaluated. Extract DNA from Vibrio cholera, Vibrio vulnificus, Vibrio alginolyticus, raised were amplified by universal primers. The results show that every vibrio has been amplified specificly and effectively, Detect vibrios under established assay. In same conditions, Repeat three times and analyze results. Under this condition, the established assay could differentiate exactly without any obvious non-specific signals repeatedly and the coefficient of variation was less than 8%. This confirmed that chip have good repeatability and stabilites.Extract DNA from Vibrio cholera, Vibrio vulnificus, Vibrio alginolyticus and other nine bacteria, raised were amplified by universal primers. Three probes detect three vibrio PCR products all have high MFI. But three probes detect other nine bacteria PCR products have low MFI without any obvious positive and non-specific signals. This confirmed that the primers were designed with good specificity and versatility. The assay has high specificity in detecting. Using serial dilutions of Vibrio cholera, Vibrio vulnificus, Vibrio alginolyticus, this assay reproducibly determined the lowest detection limit to be all approximately 101CFU/mL. It indicated that this method has high sensitivity and could be used for clinical testing.Flexible Multi-Analyte Profiling make food pathogens detected quickly, which control effectively pollution sources and prevent continue spread of bacteria so as to ensure food quality and safety.