| Objective:To analyse the association between CRHR1 polymorphism and the effect of inhaled corticosteroids(ICS) in children with asthma,and also to observe the asthma symptoms, lung function and airway inflammatory markers [PD20-FEV1 and peripheral blood Eosinophils(EOS) counts] in different phenotypes of CRHR1 gene in children with asthma, to understand the correlation between CRHR1 polymorphism and clinical phenotypes of asthma.Methods:One hundred and fifty six asthmatic children with mild persistent asthma ( 5 to14 years old ) were included as asthmatic group ( 118 males, and 38 females). 178 healthy children at the same age range were included as healthy control group( 131 males, and 47 female). Genomic DNA in white blood cell from peripheral blood were extracted for single nucleotide polymorphism analysis by direct DNA sequencing. Upstream primer: 5 'ACCCAGTGCTGTTTCCTGAG 3', downstream primer: 5 'TTGAGGCCCAGTGA CACTTC 3'. At the same time, the skin prick test and the percentage of peripheral blood EOS (EOS%) were also conducted in asthmatic children. The asthmatic children inhaled Budesonide(BUD) 200μg twice daily for 12 weeks. Before and after 12-week treatment, asthma symptom scores, lung function and histamine bronchial provocation test were measured. All statistic analysis was performed using SPSS version 13.0. Measurement data was expressed as means±SEMs. Using direct counting method to analyse the genotype frequency and the allele frequency. Using chi square test to compare the differences in the genotype frequencies,the allele frequencies,the improvement percentage of Forced Expiratory Volume in first second(FEV1)( FEV1%), and the percentage of children whose FEV1%≥5% and≥10% between two groups. T test was used to compare the differences in asthma symtoms, lung function before and after treatment. Significance was accepted at a P value of less than 0.05.Results:1. The comparison of genotype frequency and allele frequency in CRHR1 rs242941 locus polymorphism between the asthmatic group and the healthy control group.Chinese children persented polymorphism in CRHR1 rs242941, showed as GG genotype, GT genotype and TT genotype. The frequencies of GG genotype and GT/TT genotype(GT genotype plus TT genotype) in asthmatic group were 81.41%(127/156)and 18.59%(29/156)respectively, and 79.78%(142/178)and 20.22%(36/178)in healthy comtrol group respectively. There was no significantly difference in genotype frequency between the asthmatic group and the healthy control group (χ~2=0.142,P >0.05). The frequencies of G allele and T allele in asthmatic group were 0.901 and 0.099 respectively, and 0.890 and 0.109 in healthy control group respectively. There was no significantly difference in allele frequency between the asthmatic group and the healthy control group (χ~2=0.184, P >0.05).2. The association between CRHR1 polymorphism and clinical phenotype of asthma:The gender and age were not different significantly between the GG genotype asthmatic children (asthmatic GG group) and the GT/TT genotype asthmatic children (asthmatic GT/TT group) (P all >0.05). The PD20-FEV1 in asthmatic GT/TT group was (1.42±1.28)μmol , significantly lower than that in asthmatic GG group[(2.20±1.99)μmol ](t=-2.02,P=0.045), indicated the airway hyperresponsiveness in asthmatic GT/TT group was higher than that in asthmatic GG group. The EOS% in asthmatic GT/TT group was(7.16±5.09)%, significantly higher when compared to that in asthmatic GG group ([5.51±3.70)% (]t=2.01,P=0.046). The differences in daytime symptom scores, nightime symptom scores, FEV1, FEV1/Pred% ,the number of positive allergens and atopic index betweed two groups were not significant. (P all >0.05).3. The association between CRHR1 polymorphism and the effect of ICS:(1) The association between CRHR1 polymorphism and the improvement of asthma symptom scores in response to ICS :The daytime symptom scores and nightime symptom scores improved significantly after BUD treatment in both asthmatic GT/TT group and asthmatic GG group(P all <0.05). The mean improvement of daytime symptom scores in asthmatic GT/TT group was (0.75±0.12) score, significantly higher when compared to that in asthmatic GG group[(0.66±0.17)score] (t=2.827,P=0.005), but there was no significantly difference in the improvement of nightime symptom scores between two groups(t=0.490,P=0.625).(2) The association between CRHR1 polymorphism and the improvement of pulmonary function in response to ICS:The FEV1 and FEV1/Pred% improved significantly after BUD treatment in both asthmatic GT/TT group and asthmatic GG group (P all <0.05). The FEV1% in asthmatic GT/TT group was (14.89±6.82)%, significantly higher when compared to that in asthmatic GG group[(4.65±13.52)%] (t = 5.872, P = 0.007). There was significantly heterogeneity in FEV1% in response to ICS in both asthmatic GT/TT group and asthmatic GG group. The percentage of patients whose FEV1%≥5% and≥10% in asthmatic GT/TT group were 89.65% and 62.07% respectively, significantly higher when compared to that in asthmatic GG group (48.03% and 26.77%, respectively) (χ~2 were 16.582 and 13.236, respectively,P all <0.05).(3) The association between CRHR1 polymorphism and the improvement of airway hyperresponsiveness in response to ICS :The PD20-FEV1 improved significantly after BUD treatment in both asthmatic GT/TT group and asthmatic GG group (P all <0.05), indicated the airway hyperresponsiveness improved significantly. The average increasing levels of PD20-FEV1 in asthmatic GT/TT group was(0.96±1.04)μmol, significantly higher when compared to that in asthmatic GG group [(0.41±1.36)μmol] (t = 2.071, P = 0.040), indicated the improvement of airway hyperresponsiveness in asthmatic GT/TT group was higher than that in asthmatic GG group significantly. Conclusions:1. Chinese children persent polymorphism in CRHR1 rs242941, show as GG genotype, GT genotype and TT genotype.2. The CRHR1 rs242941 locus polymorphism is associated with clinical phenotype of asthma and the effect of ICS.3. The airway hyperresponsiveness and EOS% in asthmatic children with GT/TT gentoype is significantly higher than asthmatic children with GG genotype.4. The improvement of pulmonary function,airway hyperresponsiveness and daytime symptom scores in response to ICS is significantly better in asthmatic children with GT/TT gentoype than asthmatic children with GG genotype.5. The mechanism of CRHR1 rs242941 locus variant that can enhance the efficacy of ICS is not fullly clear, possible mechanism is that decreased expression or function of CRHR1, due to genetic variation, would diminish the capacity to secrete cortisol in response to inflammation, owing to decreased ACTH release. The alterations in CRHR1 rs242941 locus could have the potency to increase airway inflammation level, and to increase the capacity in response to exogenous corticosteroid.6. The establishment of the association between CRHR1 polymorphism and the effect in response to ICS in children with asthma would be expected to provide helpful references in making decisions about long-term asthma controller therapy for individual patients. |