The Reconstruction Of Ascaris Allergen And Study On Etiology In Allergic Rhinitis

Ascaris is a common human parasites, which infection in the human body can cause many diseases, including allergic diseases which is one of the common diseases. worms on the one hand can be directly secreted allergen and sensitized body, causing ascariasis allergic diseases. In the roundworm allergen, ABA-1 protein (Ascaris body fluid allergen 1) is an important allergen, which is a general term for a class of proteins.Two classes protein are contained in ABA-1, which were protein A and protein B.Protein A has four classes protein,which are named A4, A3,A2,A1 indepently. And protein B has only one unit,being named B1.For the roundworm treatment of allergic disease, desensitization therapy could be considered an effective method of treatment in aetiology, which needs to have high purity and integrity antigen epitopes. In the country the crude extract from Ascaris was studied as the Ascaris allergen,and in abroad, only one protein from ABA-1 protein was did in the past years. On the other hand, Ascaris can also change the body's immune balance which made the body more susceptible to allergic diseases. Many study showed that Ascaris antibody in asthma had relationship with the disease. But Ascaris antibody relationship between allergic rhinitis remained controversial.In order to solve the protein purity and the epitope, we conducted this experiment, trying to get protein which had high purity and integrity epitope; In the same time, we cloned and expressed ABA-1A1 gene for the function and immunological comparison with fusion protein. We used synthetic fusion protein as antigen, using the method of immunoblotting to investigate antibody positive rate of worms in allergic rhinitis, trying to find Ascaris antibody and allergic rhinitis relationship.Part OneObjectiveTo recombine and optimize the gene of Ascaris ABA-1 protein and expresse the protein in E. coli expression system, and then purify and identify fusion protein for immunotherapy, clinical diagnosis and mechanisms study.MethodsThe Ascaris allergen ABA-1 gene and protein sequences was got from Gene Bank (AF051702) and the Protein Database (Q06811), ABA-1B1, ABA-1A2 and ABA-1A1 gene was chosen from the gene according to differences of ABA-1B1, ABA-1A4, ABA-1A3, ABA-1A2 and ABA-1A1 amino acid Sequence. ABA-1B1, ABA-1A2 and ABA-1A1 gene was recombined and new fusion gene was renamed BAA which contained 1200 bp. According to E. coli codon usage bias and the degeneracy of amino acid codon, the BAA gene was optimized to be more conducive to translation in Escherichia coli; The RNA folding structure of fusion gene was predicted using DNAStar software. Local amino acid codon was adjusted so that it was more conducive to the expression in Escherichia coli. The fusion gene BAA was sythesised, and then BAA will be cloned on the expression vector PET-44a, and the recombinant plasmid was named as the PET-44a-BAA. The recombinant gene was transformed into E. coli JM109 by the way of KCM. PET-44a-BAA was idebtified by the screened on LB (Amp+), the NdeⅠand PstⅠdouble digestion and DNA sequencing, which was transformed into E. coli RosettaBlueTM. When PET-44a-BAA in E. coli RosettaBlueTM was identified correctly, the fusion protein was inducted by 37℃air bath and IPTG. The new protein was named fusion protein BAA, which was identified by 12% SDS-PAGE; Protein BAA cell was broken by ultrasound.12% SDS-PAGE gel was used to observe the target protein mainly in inclusion or supernatant, and then appropriate approach was selected to purify the protein by Ni affinity chromatography. Fusion protein BAA was identified by Western Blot and amino acid sequencing. Results1. The PET-44a-BAA plasmid from E. coli JM109 and E. coli RosettaBlueTM was identifie by NdeⅠand PstⅠdouble restriction enzyme digestion. Specific band was observed at the 1200bp,which was consistent with the target band size; Gene sequence homology of 100% was confirmed by DNA sequencing which was compared with the target gene. The plasmid PET-44a-BAA had been successfully constructed2. The fusion protein was successfully expressed in E. coli RosettaBlueTM. The induction conditions was under 37℃200 rpm air bath shaking 100 min. when the OD value was between 0.6-0.7, IPTG(0.5 mmol/L) was added into the LB. After 3 h,12% SDS-PAGE was used to observed the result. A specific target band can be seen in the 45 KD, the expression level was measured by the total crude protein of around 40%. The fusion protein was confirmed in the supernatant of BAA by 12% SDS-PAGE; The supernatant protein was purified by Ni affinity chromatography, when it was purified by non-denaturing conditions (buffer solution without adding 6 mol/L urea), the purified protein was not got.When fusion protein was purified in 6 mol/L urea denaturing conditions, purification result was ideal, and the purified protein was about 90% purity.3. The result of Western blot showed that a specific target band was observed at 45 KD. Amino acid sequencing confirmed that 15 amino acid was N T M E H Y L K T Y L S W L T E in the N terminal, which was consistent to the target protein by comparing with fusion BAA.4. Fusion gene BAA has been successfully optimized through the identification of PET-44a-B AA and the fusion protein.Conclusion The Ascaris gene ABA-1 was recombined and optimized. The fusion gene BAA was expressed effectively in E. coli.The fusion protein BAA was purified by Ni affinity chromatography, and high purity can be obtained. The fusion protein was identified as the target protein by Western Blot and amino acid sequencing.Part Two ObjectiveTo get the Ascaris allergen gene ABA-1A1 and construct expressing vector. In the E.coli expression system we want to express Ascaris ABA-1A1 protein forcomparing with fusion protein BAA in immunogenicity and antigenicity.MethodsABA-1A1 gene was cloned from the fusion gene BAA by primers A1F5'CAGCACATACCTCTCGTCGCG3'A1R:5'AGAGGTATGCACACCATAG ATCTTC3'from fusion gene BAA., pEASY2-T3-ABA-1A1 vector was built using TA cloning technology. When the plasmid was identified by blue-white selection, colony PCR and DNA sequencing, the ABA-1A1 gene was got using Ndel and PstⅠplasmid double digestion. The ABA-1A1 gene was recombined with expression vector PET-44a. The recombined plasmid was transformed into E. coli JM109 by the method of KCM to. PET-44a-ABA-1A1 was identified by NdeⅠand PstⅠdouble digestion and DNA sequencing, then PET-44a-ABA-1A1 was transformed into E. coli RosettaBlueTM. When PET-44a-ABA-1A1 were identified correctly, the protein was induced by IPTG. The results of expression was analysed by 12% SDS-PAGE.The protein was identified by Western Blot. After the sonication of ABA-1A1 cell, the supernatant and precipitation were carried out on 12% SDS-PAGE; ABA-1A1 protein was purified by Ni affinity chromatography.Results1.When the PET-44a-ABA-1A1 from E.coli JM109 and E.coli RosettaBlueTM was digested by NdeⅠand PstⅠ, a specific band was observed at the 400bp,which was consistent with the target band; The inserted gene sequence and the target gene sequence homology of 100% was shown by the DNA sequencing. This showed that PET-44a-ABA-1A1 plasmids had been successfully constructed.2. E.coli RosettaBlueTM ABA-1A1 was successfully induced to express protein. The induction conditions were at 37℃air bath for 100 min, the OD value between 0.6-0.7 and then induced by IPTG(0.5 mmol/L) for 3 h. The expression was identified by 12%SDS-PAGE. A specific target band could be seen in the 15 KD. Lysis by ultrasound revealed that fusion protein ABA-1A1 mainly exist in the supernatant; The supernatant protein was purified by Ni affinity chromatography to obtain a high purity ABA-1A1 protein.3.15 KD specific target band was found by ABA-1A1 protein allergy sera in Western blot, which showed that the protein was the target protein ABA-1A1.ConclusionThe protein ABA-1A1 was induced to express efficiently in E. coli. A material base was given to compare the immunological activity and to development the allergenic desensitization vaccine.Part ThreeObjectiveTry to find the link between allergic rhinitis and Ascaris antibody.MethodsSera of the allergic rhinitis patient and healthy people was collected for the Western Blot. Fusion protein BAA as an antigen, the Sera of the allergic rhinitis patient and healthy people were detected using Wetern Blot. The rates of Ascaris antibody were compared between them, trying to find the linkages about allergic rhinitis and Ascaris antibody.Results10 patients with Ascaris allergen antibody were in 32 Allergic rhinitis patients, and positive rate was 31.25%.2 antibody positive individuals was in 26 healthy controls, positive rate was 7.69%.two rates were detected by the X2 test, and the result was P<0.05. the difference between the two was shown significantly.ConclusionPositive Ascaris antibody was a risk factor for the allergic rhinitis.Conclusion of ArticleFusion gene BAA was expressed in E.coli effectively after being optimized using the theory of codon bias in E.coli. The BAA protein was got which had high purity and integrity epitope. Ascaris ABA-1A1 gene was coloned using PCR method, and ABA-1A1 protein was expressed effectively induced by IPTG, which was purified and identified by HPLC and Western Blot. The protein A1 laid a foundation for comparison to fusion protein BAA in immunology and function; It was showed that positive Ascaris antibody may be a risk factor for the allergic rhinitis after investigating by Western Blot with fusion protein BAA as antigen.