The Investigation On The Function And Mechanism Of Deltex-1Gene During Bone Marrow Mesenchymal Stem Cells Differtiating Into Smooth Muscle Cell

Background and Purpose:Stress urinary incontinence (SUI) is one of the most common forms of incontinence,which caused a serious effect of female social behavior and life quality. Previous studieshave showed that the major factor caused SUI is pathology or apoptosis of the periurethralsmooth muscle cells(SMCs). In recent years, adult stem cells (MSCs) transplantationbecome an important means ofregenerative medicine. However, induce MSCsdifferentiation of smooth muscle cells in vitro did not meet the purpose of the treatment ofstress urinary incontinence in the number and function.The Notch signal pathway is composed by a group of highly conserved proteins,receptors and regulation of gene transcription function, and regulation of the signal throughthetrans mission of information between the intracellular protein interactions or cell. Studieshave shown that activation of the Notch pathway can promote bone marrow mesenchymalstem cells to smooth muscle cells. Reported in the literature, by transfection intracellularNotch pathway (ICN) and otheraspects of enhanced Notch signaling, in order to furtherstudy the function of Notch pathway.Ligand of the Notch pathway is also a membrane protein expression in neighboringcells. Therefore, the Notch pathway is an important signaling molecule betweencellscommunicate with each other.Deltex-1plays the most important role in notch signal pathway, such as the regulationof lymphoid precursor cell differentiation, regulating thedifferentiation of neural precursorcells. deltex1gene is highly conserved in mammals. Deltex-1as downstream molecules ofthe Notch signaling pathway, can enhance or inhibit Notch signaling expression. deltex-1protein is highly conserved in structure. It consists of three domains: domain Ⅰ, domainⅡ and domain Ⅲ. DomainⅠ, which play an important role that contact with the Notchintracellular segment ANK structure, thereby regulating the notch signaling. DomainⅢcombined with the SH3is full of proline, its main function is to regulate the interactionbetween the protein and the protein or protein and lipid. Domain III is associated with thedegradation of deltex. Research show deltex-1regulated Notch signals positively byintergrating to the intracellular ANK repeat sequence of Notch.Studies have confirmed that the signaling pathway make bMSCs to the specificdirection of differentiation, but its mechanism is temporarily not clear. Therefore, this studyto explore bMSCs promote bMSCs effect and mechanism of the SMC differentiation,deltex-1gene in the SMC environment lay the foundation for further study using a deltex-1gene modification of BMSCs treatment of female stress urinary incontinence.MethodsThis study first separation, cultivation and identification of SD rats bMSCs, followedby cloning the Deltex-1gene, constructed adenovirus vectors pAd/Deltex-1and adenovirusvector infection in rats bMSCs observation Deltex-1genethe impact of the mouse bMSCsproliferation.Will be followed by the Deltex-1gene modification of bMSCs with SMCculture, observation of Deltex-1gene modification of bMSCs in the SMC environmentchanges, in order to explore the Deltex-1gene in bMSCs effect and mechanism of the SMCdifferentiation, as follows.1.bMSCs characteristics analysisSeparated SD rats bMSC by density gradient centrifugation (percoll1.073g/ml),specific immune antibody labeling combined with flow cytometry and osteogenesis theadipogenic purity of bMSC be identified.2.Expression of deltex-1in rat bMSCs by adenovirus vector2.1Adenovirus vector pAd/deltex-1build, viral packaging and viral titer determinationDesign amplification Deltex-1gene primers, rat liver total RNA as a template,RT-PCR amplification of full-length coding sequence of Deltex-1gene to construct cloningvectors PTA2/Deltex-1, and be identified by sequencing.PTA2/Deltex-1as a template, using KpnI and Xba1restriction sites point Deltex-1gene was subcloned into the adenovirus shuttle vector pAdTrackCMV linearized by Pme Ⅰenzyme with supercoiled backbone vector pAdEasy-1in BJ5183bacteriahomologous recombination, to form a recombinant adenoviral vector pAd/Deltex-1.Liposome lipofectamine-mediated transfection by the DNA of linearized recombinantplasmid with PacⅠ enzyme pAd/Deltex-1Health293cells for virus packaging, invertedmicroscope, whether visible green fluorescent protein (green fluorescent protein, GFP) theexpression of pathological plaque formation, whether the cells became round and otherchanges, confirmed pAd/Deltex-1adenovirus packaging whether successful.pAd/Deltex-1recombinant adenovirus,293cells successfully packaged, by the passageof the five amplified to increase its titer, and then amplified using double dilution method todetermine its titer.2.2Deltex-1gene expression detected in the rat bMSCsThe third-generation rat bMSCs adherent growth to60%~80%confluence, beDeltex-1recombinant adenovirus infection, empty virus-infected BMSCs control. Invertedfluorescence microscope and photographed. The level of the gene (RT-PCR method) andprotein (Western blot technique) to detect the expression of Deltex-1in the bMSCs.3. Deltex-1gene to promote the effect and mechanism of bMSCs to SMCdifferentiation3.1Deltex-1gene the bMSCs proliferation-the proliferation of the CurveBy Deltex-1gene modified bMSCs inoculated into four96-well plates (3000cells/150μl/hole), by empty virus and Deltex-1gene interference fragment transfected BMSCsfor experimental control, Scramble-a (CGTTTGTCCCTCCAGCATCT) the role of BMSCsas unrelated control without any treatment bMSCs as normal control. Each group,respectively,24h,48h,72h, remove a96-well plates, each well add a new medium ofCCK-8, cultured for4h under the same conditions, the oscillation30seconds mixingmicroplate determination of450nm.nm optical density, optical density value of the Y-axis,the time for the X-axis to draw the growth curve analysis of Deltex-1gene the bMSCsproliferation.3.2Immunofluorescence staining, RT-PCR and Western blot analysis of the effect andmechanism of Deltex-1gene in bMSCs SMC differentiationDeltex-1gene modification of BMSCs with SMC co-cultured withimmunofluorescence staining combined with confocal laser, the SMC-specific markerprotein α-SMA expression by RT-PCR and Western blot observation by the Deltex-1gene modified bMSCs, specific groups:①bMSC Normal control②The bMSC+empty virus③The bMSC+Deltex-1virus④The bMSC+empty virus+the SMC,⑤The bMSC+Deltex-1virus+the SMC⑥ThebMSC+Deltex-1interfere with+the SMC,⑦the SMC normal controls. In order toinvestigate the effect and mechanism of Deltex-1gene in bMSCs to SMC differentiation.Results1. Culture and identification of bMSCsRats initial generation bMSC of density gradient centrifugation of SD, after24hincubation, the adherent growth of spindle-shaped, cultured for7days, pick whichevermonoclonal passage monoclonal bMSCs was amplified, set the incubator to cultivate7to10d, and observe the cells grow well.Specific immune antibody labeling combined with flow cytometry found that thebMSC the of CD90, CD44-positive,99.57%and85.66%, respectively, of CD45expressionwas negative, the positive rate of0.35%; osteogenic induction, alizarin red staining,likecalcium precipitation in the three weeks after the cytoplasm; oil red staining of adipogenic,about three weeks, the perinuclear visible highly refractive fat drops appear to continue tofoster a week, fat droplets gradually increased.2. Expression of deltex-1in rat bMSCs by adenovirus vector2.1Adenovirus vector pAd/Deltex-1build, viral packaging and viral titerdeterminationSequencing confirmed that the clone to the Deltex-1gene full-length coding sequencewas successfully constructed its recombinant adenovirus vector pAd/Deltex-1.Liposome mediated recombination pAd/Deltex-1virus DNA transfection healthy293cells for virus packaging, and10d after the visible GFP expression under an invertedmicroscope, pathological plaque formation, cells became round, swelling, off the wall andthe nucleus changeand large changes accordingly pAd/Deltex-1adenovirus packagingsuccess. Enhance the titer of the packaging success pAd/Deltex-1-virus by the passage ofthe five amplified, and then amplified, using the double dilution method to determine itstiter:1.23×1010IU/mL,2.2Deltex-1gene expression detected in the rat bMSCsIsolated from monoclonal cultured bMSCs, by the Deltex-1virus infection every3~5 d of passage1, passage3, compared with non-infected BMSCs form no abnormal changes.Inverted fluorescence microscope can be seen the strong expression of the GFP controlgroup, on the contrary. Extraction of total RNA of the cells as a template, using the strongR-PCR method can detect Deltex-1gene expression in the control group Deltex-1geneexpression was relatively weak. Western blot results showed that of BMSCs infectedpAd/Deltex-1virus detection, approximately67kDa appeared strong Deltex-1proteincorresponding staining with the control group, this band is weak. These results suggest thatexogenous genes Deltex-1expression in bMSCs normal coding.3. The role of Deltex-1gene in bMSCs to SMC differentiation and its mechanisms3.1Deltex-1gene the bMSCs proliferation-the proliferation of the CurveThe third-generation bMSCs the overall growth trend for3days incubation period,3for5days for the rapid proliferation of6~7d of the plateau. CCK-8assay results showedthat the cells in each group the growth trend in line with this, but by the proliferation ofDeltex-1gene-modified BMSCs for72h was significantly slower in the other groups (P<0.01).3.2Immunofluorescence staining, RT-PCR and Western blot analysis of the effect andmechanism of Deltex-1gene in bMSCs SMC differentiationDeltex-1gene modification of BMSCs with SMC co-cultured withimmunofluorescence staining combined with confocal laser by RT-PCR and Western blotcould be detected in Deltex-1gene modified bMSCs strong expression of SMC-specificmarker protein α-SMA, and normal controls with empty virus infection group was relativelyweak, almost no expression of these marker proteins by Deltex-1gene interferencefragment transfected bMSCs. These results indicate that the Deltex-1gene can promoteBMSCs to SMC differentiation.Conclution1. In this study, successfully separated to high purity bMSCs2. Cloned into the Deltex-1gene full-length coding sequence, was successfullyconstructed its recombinant adenovirus vector pAd/Deltex-1, the carrier can be a viruspackaging, and access to a titer of1.23×1010IU/mL of infectious virus.3. Successful implementation of Deltex-1gene expression in SD rats bMSCs.4. Deltex-1gene modified BMSCs for72h, proliferation was significantly affected by suppression, compared with the control group, P<0.01.5. Compared with the unmodified bMSCs, Deltex-1gene modification of BMSCs andSMC co-cultured high expression of SMC-specific protein alpha-SMA. Deltex-1gene canpromote BMSCs to SMC differentiation.