Cloning, Mapping, Imprinting Status, Tissue Expression And Methylation Analysis Of PHLDA2Gene In DaZu Black Goat | | Posted on:2015-03-27 | Degree:Master | Type:Thesis | | Country:China | Candidate:L F Su | Full Text:PDF | | GTID:2253330428480434 | Subject:Zoology | | Abstract/Summary: | PDF Full Text Request | | The goat breeding is one of the animals agricultural pillar industries. In recent years, as people diet adjustment, high nutritional value food which is good for health becomes more and more popular. High nutritional value mutton increase the market demand, therefore it is the key to improve the goat breeding rate for meeting the demand of goat market. The generally lower breeding rate of sheep and goats limit the large scale breed. The number of survival goat is one of influence factor for reproductive performance. Relevant research reports that the normal growth and development of the placenta play an important role for fetus. The placenta, the source of nutrient supply of fetus, is very important for the fetus normal growth and development.PHLDA2(pleckstrin homology-like domain, family A, member2, also known as the IPL or TSSC3) encodes small cytoplasmic protein with PH (pleckstrin homology) homology domain, which regulates cell signal, package transportation and so on. Many studies have shown that PHLDA2gene is a maternal imprinting gene in mouse and human, regulating placental growth and development and glycogen storage. Therefore, it is of great significance to research about the goat PHLDA2gene. In this study, we cloned the full length cDNA of PHLDA2gene from goat using RACE method and made a detailed bioinformatic analysis, simultaneously expression profiles of PHLDA2in different tissues were constructed; Through the direct sequencing of the RT-PCR, the imprinting status of PHLDA2gene in placenta tissue of F1heterozygotes was analyzed; The promoter of goat PHLDA2gene was cloned using the method of nested PCR and we used the method of modification of methylation specific PCR (MSP) method to draw methylation mapping from the first exon regions and promoter areas of PHLDA2gene in the placenta and spleen tissue. Through the experiment to get the following results:In this study, the goat placenta tissue was adopted for material and we successed in obtaining the full length cDNA of PHLDA2gene of935bp based on homology cloning method, using the RACE technology. The cDNA consists of a coding sequence of42Obp,5’UTR of62bp,3’UTR of62bp and polyA of32bp with termination coden of TAA.The coding region encodes a140-amino-acid-residues protein which was predicted to have a molecular weight of15638.7Da and an isoelectric point of9.18.Bioinformatics analysis of deduced PHLDA2nucleotide sequence and amino acid sequence of PHLDA2showed that the PHLDA2shared91%,90%,89%,90%and90%nucleotide sequence similarity to cattle, pig, human, monkey and horse, respectively. The PHLDA2respectively shared99%,93%, and93%amino acid sequence identity to Bos taurus (NP001069989), Sus scrofa (NP001167528), Homo sapiens (NP003302), the result indicated that amino acid sequence of PHLDA2was conserved in mammalian, and explained that the PHLDA2protein differentiation of common ancestor started from in a relatively close time.In order to investigate the tissue specific distribution of PHLDA2gene, real-time PCR was performed to measure gene expression. Fluorescence quantitative results show that the PHLDA2gene in heart, liver, stomach, lung, kidney, brain, tongue, placenta, muscle tissues was be detected, but no expression in the spleen. The PHLDA2mRNA content in the placenta (P<0.01) was significantly higher than that of other tissues. It was very lower expression in other tissues and difference among tissues were not significant (P>0.05). It is conservative between PHLDA2gene expression and function in mammalian. We can infer that PHLDA2gene also has a negative control function for goat placenta growth and development.It has been proved that PHLDA2gene was maternally expressed in fetus and placenta of cattle. The imprinting status analysis result showed that PHLDA2gene also was maternally expressed in the goat placenta. It was further proved that the imprinting status of PHLDA2gene was conservative in mammalian. By BLAST analysis to align cDNA sequence and the goat genome sequence in the NCBI, we found PHLDA2gene was located in goat29chromosomes, adjacent to NAP1L4and SLC22A18gene, the result for the separation of goat the imprinting area provided a foundation for the further study of the function.We obtained1842bp sequence, including1822bp promoter sequence and5’UTR of20bp using genomic DNA as template from muscle tissue of DaZu Black goat through nested PCR amplification. We found three core promoter sequences:TAGGCTGTTTTGAAAGTGGGGGCCCT GGAGCAGGTGGGGCCCCACAGATC(starting:-990. the end-836, score:0.97), GCCCGGGGG CGTGCCCGGGGCGGGGGGGGCGGAGCGCGCCAGCGCGGCCA (starting:-82, end:-42s core:0.86) and GCGCGGCCACTATAAAGGCGGCTCCCACGCCGCCTGAGTGCATCCCTCAC (starting:-40, the end:9, score:1.0). Compared with three deduced core promoter sequences, there may be a promoter activity center located on the region of-40bp-9bp.By methylation specific PCR (MSP) method, CpG island methylation of the first exon area and promoter of PHLDA2gene was analyzed in goat placenta and spleen tissue. Methylation pattern mapping results showed that the methylation level from promoter region of the placenta and spleen tissue were22.6%and36%, respectively, methylation level from the first exon region of placenta and spleen tissues were1.28%and44.2%, respectively. In conclusion, the methylation lever from CpG island of goat PHLDA2gene in placenta and spleen tissue were10.3%and40.6%, respectively. | | Keywords/Search Tags: | Goat, Imprinted Gene, PHLDA2, Tissue Expression Profile, GeneMapping, Methylation | PDF Full Text Request | Related items |
| |
|