The Construction Of Tumor Specific Promoter Survivin In Regulation Of Shrna Adenovirus And The Inhibition Of The Expression Of CD133Gene In HEPG-2Cells

Methods;1.Build pEntry-Sur-GFP-shRNA eukaryotic expression vector; Survivin, a member of inhibitor of apoptosis (1APs) family; Refer to kit instructions and extract HepG-2cell genome DNA. According to the GenBank (B222to t39, GeneBank Accession NumberAY795969) providing survivin promoter gene sequence and pEntry carriers enzyme site set sal1and Nde I enzyme site (downstream primer sequence) amplification fragment for270bp will survivin promoter cloning to pEntry-EF1-GFP-shRNA to replace EF1promoter, constructing the pEntry-Surp-GFP-shRNA eukaryotic expression vector[13].2. pEntry-Surp-GFP-shRNA transfect Hela. HepG-2.293T cell line.3. RT-PCR detection GFP to confirm GFP expression driven by surviving.2.Designed the shRNA for CD133and Packing the Ad.surp-GFP-shRNA adenoviruses:According to CD133nucleotide series in GenBank, referring to the design principle of Ambion company’s designer siRNA, to design three interference series GCTCAGAACTTCATCACAAAC (Start position:2377) AAGCCAGAAACTGTAATCTTAG(Start position:485); ATGAGATTAAGTCCATGGCAAC(Start position:972); Through the Blast retrieval to determine three interference fragment and other different human genetic source; shRNA synthesis; three interference fragments are cut into six small fragments and send them to BGI Company to synthesize12strips Oligo fragments. ultraviolet spectrophotometer is used at260nm wavelength quantitative.(3) Cut out the shRNA from pEntry-SUR-GFP-shRNA,(4)with the function of T4ligase, making the synthesized shRNA927, shRNA482,ShRNA2377connect with pEntry-Surp-GFP vector respectively (5) Through gateway kit, pEntry-Surp-GFP-shRNA having been built will restructure adenovirus plasmid pAd-Surp-GFP-shRNA, to product transformation TOP10competent bacteria, kanamycin, LB plate, in each plate to choose three positive clone wave bacteria for the night train. Extraction plasmid, Pac Ⅰ enzyme identification restructuring pAd-Surp-shRNA construct successful, extraction plasmid survey plasmid concentration of A260/A280=1.8032; A260/A280=1.8230; A260/A280=1.7104as shown in figure3;After being sent to the sequencing, the results are correct.;In293A cell packing pAd-Sur-shRNA:through the formula calculation for7.01x10^10TU/ml.3.to use packed good virus for transfection HepG-2cells, training72h fluorescence microscope observation virus transfection cell.Through gateway kit, pEntry-Surp-GFP-shRNA having been built will restructure adenovirus plasmid pAd-Surp-GFP-shRNA, to product trans formation TOP10competent bacteria, kanamycin, LB plate, in each plate to choose three positive clone wave bacteria for the night train. Extraction plasmid, Pac I enzyme identification restructuring pAd-Surp-shRNA construct successful, extraction plasmid survey plasmid concentration of A260/A280=1.8032; A260/A280=1.8230; A260/A280=1.7104as shown in figure3;After being sent to the sequencing, the results are correct.;In293A cell packing pAd-Surp-shRNA:through the formula calculation for7.01x10^10,TM/ml,to use packed good virus for transfection HepG-2cells, training72h fluorescence microscope observation virus transfection cell.4.Tumor Specific Promoter Survivin in Regulation of shRNA Eukaryotic Expression Vector Adenovirus and the Inhibition of the Expression of CD133Gene in HepG-2Cells.Tumor Specific Promoter Survivin in Regulation of shRNA Eukaryotic Expression Vector Adenovirus and the Inhibition of the Expression of CD133Gene in HepG-2Cells a recombinant adenovirus, Ad-SUR-shRNA, that expressed the shRNA CD133under control of the survivin promoter was constructed; Transfected into HepG-2cells RT-PCR, Western blot were used to detect the expression of CD133;The proliferation and invasion of HepG-2Cells were determined by MTT assays and Transwell assay respectively; Compared with untransfected cells, Transfected HepG-2cells were inhibited significantly at both mRNA and protein levels,the cell apoptotic rate was increased significantly in HepG-2cells We conclude that expression of shRNA CD133under control of the survivin promoter can likely be used to achieve cancer-specific expression of shRNA in many types of cancers In combination with Chemotherapy and radiation therapy, this strategy is a possible method of cancer gene therapy;The down regulation of CD133severely reduced the capacity of the cells to metastasize, in addition to its role as a CSC marker, is an important therapeutic target for cancer of the liver and, potentially, for other CD133-expressing cancer types.