| BackgroundCancer stem cells (CSCs) have been demonstrated in laryngeal carcinoma. CD133is a useful putative marker for CSCs in human laryngeal tumors, as well as in other cancers. Many studies have found that CD133+CSCs possess higher clonogenicity, invasiveness, and tumorigenesis compared with CD133-cells. CD133+cells are resistant to standard chemotherapy and radiotherapy. However, whether CD133+CSCs have distinct metabolic programs from the bulk of tumor cells is not well established. Certain regulatory pathways, such as the Wnt, Notch, Hedgehog, and PI3K/Akt pathways, have been found to play important roles in governing cell metabolism and energy sensing of CSCs.Recently, the interest in the Warburg effect of the niche of CSCs has escalated. Because18F-fluorodeoxy glucose positron emission tomography (18FDG PET) is widely used in clinical oncology and may be useful in disease diagnosis, staging, restaging, therapy monitoring in many cancers, and cervical metastasis of carcinoma from an unknown primary tumor. The Warburg effect dictates that cancer cells rely on glycolysis rather than oxidative phosphorylation under aerobic conditions. In many cancer cells, glucose is used mainly for the glycolytic pathway. Stem cells have been found to express high levels of glycolytic enzymes and rely mostly on glycolysis to meet their energy demands. Glucose is transported through cell membranes by glucose transporters (Glut). Many studies, including ours, have revealed that Glut-1plays a significant role in malignant glucose metabolism and that it might contribute to the increased FDG uptake. However, studies of Glut-1expression in CSCs are limited. In CD133+thyroid cancer, infantile hemangioma, and embryonal neoplasms of the central nervous system, Glut-1exhibited higher expression than in CD133-cells. Thus, the role of the Warburg effect and Glut-1in CSCs should be further studied.In our previous studies, we revealed high Glut-1expression in laryngeal carcinoma. We also found that antisense Glut-1may decrease glucose uptake and inhibit the proliferation of Hep-2cells. In the present study, we investigated the proliferation of CD133+Hep-2cells, and whether Glut-1is expressed in laryngeal carcinoma CD133+Hep-2cells.Materials and methods1.Cell Culture. The laryngeal carcinoma Hep-2cell line was purchased from the Cell Research Institute of the Chinese Academy of Sciences (Shanghai, China). Hep-2cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO-BRL, Gaithersburg, MD) containing10%heat-inactivated fetal bovine serum (FBS; Hyclone, Logan, UT),2mM L-glutamine,100U/ml penicillin, and100g/ml streptomycin at37℃in a5%CO2atmosphere. Cells were trypsinized and harvested after reaching80-90%confluence.2.Detection of CD133Expression in Hep-2Cells by Real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Cells were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA). Total RNA was extracted from cells according to the manufacturer’s protocol. The concentration of total RNA was measured by ultraviolet spectrophotometry; an optical density (OD)260/280ratio between1.8and2.0was deemed to be acceptably pure. Reverse transcription was performed according to the manufacturer’s protocol. Briefly,1μg of total RNA and the Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Fermentas, Canada) in a20-μl reaction volume consisting of0.5μg/μl of oligo d(T) primer,1μl of random primers (0.2μg/μl), and10μl of DEPC·H2O. The reaction mix was first pre-denatured at65℃for10min. After addition of200U M-MLV reverse transcriptase (Fermentas, Canada), the samples were incubated at42℃for1h and annealed at70℃for10min. The above-synthesized cDNA was used as a template for real-time fluorescent quantitative PCR using the fluorescent dye SYBR Green and the Eppendorf Realplex4real-time PCR system (Eppendorf Realplex4; Hamburg, Germany). The20-μl reaction mix consisted of10μl of2SYBR Green,1μl of template,1μl of upstream and downstream specific primers, and8μl of deionized water. The reaction mix was pre-denatured at95℃for2min, followed by40cycles at95℃for15s,59℃for20s, and72℃for20s. Each primer sample was run in triplicate. The primers used were as follows:CD133-Forward (F):CACTTACGGCACTCTTCACCTG; CD133-Reverse (R): CCAGTCTGAGCCAAGTAGCTGTC. Glyceraldehyde3-phosphate dehydrogenase (GAPDH) was used as an internal standard for data calibration (GAPDH-F: GGGTGTGAACCATGAGAAGTATG; GAPDH-R: GATGGCATGGACTGTGGTCAT). The lengths of PCR products were213bp (CD133) and145bp (GAPDH).To distinguish between specific and non-specific products and primer dimers, dissociation curve analysis was conducted immediately after amplification by continuous monitoring of the SYBR Green â… fluorescence signal at temperatures between60℃and95℃. For calculation of differential gene expression, the2-△△Ct formula was used.3.Flow Cytometry (FCM) and Fluorescence-activated Cell Sorting (FACS). Cultured cells were trypsinized using0.25%trypsin and rinsed in phosphate-buffered saline (PBS). The cells were centrifuged at800g for5min and resuspended in up to500-μl PBS. Cell suspensions were incubated with phycoerythrin (PE)-conjugated CD133antibody in the dark for30min at room temperature. During the reaction, vortexing was performed for5min. After the reaction, the cells were rinsed with PBS, and resuspended in up to400-μl PBS. Flow analysis was performed using a FACS instrument (Becton Dickinson, Mountain View, CA). CD133+and CD133-cells were sorted. CD133-sorted cell populations were again suspended in serum-free medium (SFM; Sigma-Aldrich, St. Louis, MO, USA). The purities of sorted CD133+and CD133-cells were evaluated by flow cytometry.4.Proliferation Assays of CD133+Hep-2Cells using the Cell Counting Kit-8 (CCK-8) System. Cultured CD133+and CD133-Hep-2cells were trypsinized using0.25%trypsin. Cell proliferation was measured using the CCK-8system (Beyotime, Nanjing, China), according to the manufacturer’s instructions. Briefly,5103CD133+or CD133-Hep-2cells were seeded into96-well culture plates. Cells were cultured in SFM at37℃. After1-6days,10μl of CCK-8reagent was added to each well, and after2h of incubation at37℃, the absorbance was measured at450nm. OD=ODceii-ODblank.5.Expression of Glut-1mRNA in CD133+and CD133" Hep-2Cells by Real-time RT-PCR. Real-time RT-PCR was performed as described above. Briefly, CD133+and CD133-Hep-2cells were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA). Total RNA was extracted from cells according to the manufacturer’s protocol. Using1μg of total RNA and MMLV in a20-μl reaction volume, the reaction mix was first pre-denatured at65℃for10min. After the addition of200U MMLV, the samples were incubated at42℃for1h and annealed at70℃for10min. The above-synthesized cDNA was used as a template for real-time fluorescent quantitative PCR. The20-μl reaction mix consisted of10μl of2SYBR Green,1μl of template,1μl of upstream and downstream specific primers, and8μl of deionized water. The reaction mix was pre-denatured at95℃for2min, followed by40cycles at95℃for15s,59℃for20s, and72℃for20s. Experiments were performed in triplicate and were repeated at least twice independently. The primers used were as follows:Glut-1-Forward (F): CCGCAACGAGGAGAACCG; Glut-1-Reverse:GTGACCTTCTTCTCCCGCATC. GAPDH was used as an internal standard for data calibration (GAPDH-F: GGGTGTGAACCATGAGAAGTATG; GAPDH-R: GATGGCATGGACTGTGGTCAT). Dissociation curve analysis was conducted. For calculation of differential gene expression, the2-△△Ct formula was used.6.Glut-1Protein Levels in CD133+and CD133-Hep-2Cells by Western Blotting. Western blotting was performed as described previously (26). The Glut-1and β-tubulin (as a control) protein in each group of Hep-2cells were assayed using a BAC protein quantitative kit (Wuhan Boster Biological Technology Co. Ltd., Wuhan China). Briefly,80μg of protein was subjected to10%sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a nitrocellulose membrane (Millipore, Billerica, MA, USA). Skimmed milk (2%) was used as a blocking solution (room temperature,1h). The membrane was incubated with the primary antibody (Glut-1,1:1000; β-Tubulin,1:5000) at room temperature for3h, and with the secondary antibody (1:5000, donkey anti-rabbit;1:2000, donkey anti-mouse) at room temperature for1h. The proteins were detected using an enhanced chemiluminescence system (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and were exposed to X-ray film. Protein expression was analyzed semi-quantitatively using the Kodak Gel Logic Analysis System.7.Statistical Analysis Statistical analyses were performed using SPSS for Windows, version19.0. A P-value less than0.05was deemed to indicate statistical significance.Result1.Expression of CD133in the Hep-2Cell Line. Real-time RT-PCR showed that the sizes of the CD133and GAPDH PCR product were213and145bp, respectively (Figure1). Dissociation curve analysis performed between60℃and95℃showed only the expected peaks at82.1℃and85.1℃for CD133and GAPDH, respectively (Figure2). The analysis showed that each primer pair had sufficient specificity for use in the present study of CD133expression. The meanâ–³Ct of CD133expression was10.98.2.Detection of CD133+Hep-2Cells by FCM. CD133cells were isolated from the Hep-2cell line using FCM. To evaluate the efficiency of FCM, harvested cells were subjected to FACS analysis. Before isolation, the CD133+fraction was1.2%, which increased to76.1%after isolation (Figure3). Successive tests also proved that cells grew well after isolation.3.Proliferation of CD133+Hep-2Cells. After isolation, CD133+and CD133-cells were cultured separately in SFM. Proliferation is shown in Table1and Figure4. The proliferation of CD133+and CD133-cells was not different during the first3days (P>0.05). From day4, however, the proliferation capacity of CD133+cells in vitro was higher than that of CD133-cells (P<0.05).4.Glut-1mRNA Levels in CD133+and CD133" Hep-2Cells. Real-time RT-PCR showed that the sizes of the Glut-1and GAPDH PCR products were123bp and145bp, respectively (Figure5). Dissociation curve analysis performed between60℃and95℃showed only the expected peaks at86.2℃and85.1℃for Glut-1and GAPDH mRNA, respectively (Figure6). Thus, the analysis showed that each primer pair had sufficient specificity for use in the present study of Glut-1mRNA expression. The mean ACt of Glut-1mRNA expression in CD133+cells was1.78. The meanâ–³Ct of Glut-1mRNA expression in CD133-cells was1.00. The expression of Glut-1mRNA differed significantly between CD133+and CD133-cells (P<0.05).5.Glut-1Protein Levels in CD133+and CD133-Hep-2Cells. Mean Glut-1protein levels in CD133+Hep-2cells and CD133-Hep-2cells relative to β-tubulin were0.48±0.02and0.21±0.03ug/ul, respectively (P<0.05; Figures7).Conclusion1. CD133+cells showed higher proliferation. Glut-1mRNA and protein levels were higher in CD133+than in CD133-cells.2. Our results suggest that Glut-1plays a role in the energy supply of laryngeal CD133+Hep-2cells, and Glut-1may represent a potential therapeutic target for inhibition of the proliferation of laryngeal CSCs. |