Molecular Cloning And Expression Patterns Of Tet1 Gene In Goat Placenta

Producing high-quality kids is a precondition for raising economic benefit in goat husbandry. Evaluation of goat reproduction traits don’t only embody in the high litter size, also the quality and survive rate of kidding. All of them, pregnancy maintenance, fetal development, and even postnatal growth, are based on the normal development of the early placenta. TET1 protein, a DNA methylation hydroxylase, is one of the members of Fe2+ and 2-oxoglutarate-dependent dioxygenases that successively oxidize 5-methylcytosine(5m C) to 5-hydroxy-methylcytosine(5hm C), 5-formylcytosine(5f C) and 5-carboxylcytosine(5ca C) in DNA active or passive demethylation mechanism, of which 5f C and 5ca C can be removed by thymine DNA glycosylase(TDG) and replaced by cytosine via base excision repair(BER) in DNA active demethylation. Therefore, it plays a great significance for maintaining self-renewaling and pluripotency of embryonic stem cells, ensuring stem cells to differentiate into different tissues. However, its molecular mechanism have not been analyzed at regulating the placental development in early pregnancy. Here we cloned caprine Tet1 promoter and coding sequence and detected its expression patterns in different development stages of goat placenta, which lay the foundation of goat molecular breeding, relevant applied or basic researches.The main findings are as follows:We first cloned goat Tet1 whose full-length sequences of 7056 bp by RT-PCR and RACE ending amplification(Gen Bank:KU870424), open reading frame(ORF) of 6507 bp and amino acids sequences of 2168 aa were respectively obtained. Protein predicting showed Goat TET1 protein was a non secretory and non bounding membrane hydrophilic globular protein which was 239677.2Da. We used previous total DNA as template to obtain 5 ‘untranslated region of goat Tet1 gene about 856 bp without Cp G island and two core promoter regions were showed ‘GATCAGACCTGTGTCCCCTGCACTGGCAGC CAGATTCTTATCTACTGTAC’ and ‘TTCTTGAAGTGCACAGGCTTCTCATTGTGG TGGCTTCTTTTATTTTGGAT’. Compared with Goat another TET dioxygenase families, TET1 protein had low sequences homology for the TET2(24.9%) and TET3(23.9%); Compared goats with different species such as cows, horses, humans, monkeys, mice, chimpanzees, rats and pigs, TET1 homology respectively were 95.4%, 86.1%, 78.3%, 78.3%, 56.7%, 76.5%, 57.9% and 87.3% and the highest homology is bovine, lowest homology is mouse.The tissue expression of Goats Tet1 analysis showed the highest Tet1 expression was muscle, the expression of reproductive tissues such as testis, cotyledons, ovarian were relatively high. The lowest expression of Tet1 is in the liver and kidney, the results indicated that goat Tet1 may be connected to reproductive-related physiological processes.We analyze Tet1 expression in the different stages of pregnancy of goat by QRTPCR showed Tet1 expression level in fetal placenta of 25 day gestation was(P < 0.01) higher than the 60 d,90 d, 120 d and 150 d and was higher(P < 0.05) than the 20 d and 30 d of pregnancy, and there is a decreased trend of Tet1 expression in 25 d, 30 d,60 d,90~120 d and 150 d. This result preliminary suggests that Tet1 be likely to play an important role in early pregnancy(implantation and fetal formation). Results of quantitative real time PCR of Dnmts showed that the methylation marker Dnmt3 a expression is increased in placenta of 20 d, 25 d and 30 d pregnancy, Dnmt1 expression in placenta of 30 d is significantly(P<0.01) higher than any other stage. Immunofluorescence experiments showed that DNA methylation markers 5m C expression in the early weeks of pregnancy goats(20 d, 25 d and 30 d) is weak.This study is the first time to successfully clone goat Tet1 gene,c DNA whole sequence is 7056 bp(Gen Bank:KU870424), and received goat Tet1 gene 5 ‘end upstream regulation sequence(5’UTR) 856 bp. Preliminary we find that Tet1 gene play an important role in goat placental development during early pregnancy and mechanism of demethylation, in order to further study the gene biology function and its related regulatory mechanism on fetal placenta laid a foundation.