Font Size: a A A

Effect Of 27 Natural Product Monomers On Drug Metabolism Of Channel Catfish

Posted on:2021-05-22Degree:MasterType:Thesis
Country:ChinaCandidate:Z Y WangFull Text:PDF
GTID:2393330611961471Subject:Aquaculture
Abstract/Summary:PDF Full Text Request
Pregnane X receptor(PXR)as a ligand dependent transcription factor,is capable of regulating gene expression of cytochromes P450 and transporters involved in xenobiotic/drug metabolism and elimination.Due to the species differences in the regulatory specificity of PXR,gene regulation should not be extrapolated from mammal to fish without research data.There were very few researches on drug metabolic enzymes in channel catfish in vivo and in vitro.In our work,we first analyzed the expression and distribution of PXR and cytochrome P4503A30 genes in various tissues of catfish catfish,in order to provide data support for studying the effects of PXR and CYP3A30 on the drug metabolism of catfish catfish in vivo and in vitro.The toxic effects of 27 natural product monomers on kidney cells were also measured.Then in order to screen out monomers that can induce gene expression and enzyme activity,we investigated the effects of 27 natural product monomers monomers on PXR,CYP3A30,and MDR1 genes expression and CYP3A enzyme activity in CC-K cells.Finally,we carried out an in vitro test to analyse the effect of the Chinese medicine monomer on the residual elimination rule of the typical antibacterial drug sulfamethoxazole in the catfish catfish.1. The expression and distribution of PXR and CYP3A genes in channel catfishFirst,five different pairs of primers were designed for the PXR and CYP3A genes by different ways respectively.Then,the primers were evaluated by PCR and q-PCR technology,and the primer No.3 of PXR and primer No.4 of CYP3A30 were selected(PXR-3F:GGCTGGACTCAGGCTTATTT,PXR-3R:CGAGCTGTGGTCTGTGATTT;CYP3A-4F:GTGTTCTCTCTCCATCCTTCAC,CYP3A-4R:CTCGTCACCACATCC ATACTG).Their amplification efficiency were 100.64%and 95.16%,the slopes were-3.307 and-3.444,R2 were 0.997 and 0.992 respectively.The parameters of PXR-3 and CYP4A-4 meet the experimental requirements.Then we measured the expression and distribution of PXR and CYP3A genes in various tissues of channel catfish via q-PCR technology.The results showed that the sequence of PXR expression level in tissues of channel catfish was gill,kidney,hindgut,heart,foregut,spleen,midgut,brain,skin,liver and muscle.The expression of PXR gene in gills and kidneys was significantly higher than that in other tissues(P<0.05).The oder of the expression levels of CYP3A gene in various tissues was foregut,hindgut,midgut,gills,liver,kidney,spleen,skin,brain,heart,and muscle(from high to low).And the results showed that in the foregut,midgut and hindgut the expression of CYP3A gene was significantly higher than other tissues(P<0.05);2. Effect of 27 traditional Chinese medicine(TCM)monomers on PXR and drug metabolizing enzymes in channel catfish kidney(CC-K)cellsWe took the CC-K cells as the research object,the toxicity experiment of 27 TCM monomers on CC-K cells was carried out.Observed and recorded the no observed effect level of monomers to CC-K cells.Then the half-lethal concentration of TCM monomers was analyzed and the IC50chart was made by software.Additionally,our work investigated the effects of 27 natural product monomers on PXR,CYP3A30 and MDR1genes in CC-K cells.The results showed that bisdemethoxycurcumin,glycyrrhetnic acid,rotenone,artemisinin,dihydroartemisinin,ligustilide and matrine strongly induced the m RNA levels of PXR.Additionally,the up-regulation of CYP3A30 gene run parallel with PXR gene after the treatment of demethoxycurcumin,glycyrrhetnic acid,artemisinin,matrine,baicalein,schisantherin A,ligustilide and dihydroartemisinin.Moreover,we found that natural products schisandrin A,schisandrin B,schisandrol A and schisandrol B significantly up-regulated the m RNA level of MDR1 gene.Our work with a view to provide experimental data support for further research,which will make for the rational application of natural products in channel catfish,such as to avoid adverse herb-drug interactions or accelerating the residue elimination of chemical medicine.3. The effect of artemisinin and hypericin on the metabolic rate of sulfamethoxaz-ole in the catfish catfishThe elimination regularity of SMZ residues were investigated in the tissues of Ictalurus punctatus with a 100 mg/kg body weight after single oral administration at the water temperature of(25±2)℃.Then the experimental group was given oral administration of hypericin and artemisinin respectively,and the control group was given oral administration of distilled water.The results indicated that artemisinin can significantly accelerate the elimination of SMZ residues in channel catfish.However,hypericin inhibited the metabolism of SMZ in fish.When artemisinin and hypericin are used in combination with sulfamethoxazole in aquaculture,they should be pay more attention.
Keywords/Search Tags:pregnane X receptor, CYP3A, channel catfish, natural product monomers, drug metabolism
PDF Full Text Request
Related items