Expression And Identification Of Recombinant Lentivirus Mediated Macaca Mulatta Antisense MiR-155 In Macaca Mulatta Immature Dendritic Cells

Objectives:Construction and identification of macaca mulatta antisense miR-155(Micro RNA-155)lentivirus vector;induction and culture of immature dendritic cells in macaca mulatta;transfection of macaca mulatta immature dendritic cells with recombinant antisense miR-155 lentiviral vector;PCR(Polymerase Chain Reaction)was used to detect the expression of miR-155 in macaca mulatta immature dendritic cells..Methods:1.Lentiviral vector was digested and ligated with the annealed double stranded DNA of the target gene.The product was added into the competent cells.Then sequencing the cultured vector.Packaging lentiviral vector.After concentrated and purified,the titer of the virus was determined using drug screening method.2.Macaca mulatta peripheral blood was used to induce and culture immature dendritic cells in vitro by adding cytokine GM-CSF(Granulocyte-Macrophage Colony Stimulating Factor)(100ng/ml)and IL-4(Interleukin-4)(50ng/ml).Immunophenotype identification and ultrastructural observation were carried out by flow cytometry and scanning electron microscope.3.Macaca mulatta immature dendritic cells were transfected with recombinant lentiviral vector.RT-q PCR(Real-time Quantitative Polymerase Chain Reaction)was used to detect the expression of miR-155 in macaca mulatta immature dendritic cells.Results:The result of sequencing showed that the target sequence was consistent with the previous design sequence(ACCCCTATCACGATTAGCATTAA).After cell packing and purification,the titer of the virus was determined to be 2E+9TU/ml using drug sieving method.Dendrites and branches were observed in the induced and cultured cells under 400 X light microscope.The results of flow cytometry and scanning electron microscopy showed that the immunophenotype and ultrastructure of the cells were consistent with those of immature dendritic cells.The recombinant lentiviral vector was transfected into macaca mulatta immature dendritic cells.The results of RT-qPCR analysis showed that The inhibition of miR-155Conclusions:Construction of macaca mulatta antisense miR-155 lentiviral vector by ligating antisense miR-155 with lentivirus vector.Then immature dendritic cells were infected with recombinant lentiviral vector.The down regulation of miR-155 was detected by RT-qPCR,and the target gene was successfully expressed in the target cells.Prospect:Transfection of macaca mulatta immature dendritic cells by recombinant lentiviral vector mediated macaca mulatta antisense miR-155,expecting to obtain dendritic cells that lead to immune tolerance,and study on immune tolerance of macaca mulatta liver transplantation with these dendritic cells.