Font Size: a A A

The Role And Mechanism Of Astrocyte Phagocytosis Receptor MERTK In Stress-induced Cognitive Dysfunction

Posted on:2024-05-04Degree:MasterType:Thesis
Country:ChinaCandidate:B M GuoFull Text:PDF
GTID:2544307094976889Subject:Public health
Abstract/Summary:
Chapter 1.Changes in astrocyte phagocytosis receptor MEGF10/MERTK in stress-induced cognitive dysfunctionObjective: The effect of chronic restraint stress on the cognitive function of rats was observed,and the pathological changes of neurons in the prefrontal cortex,hippocampus,amygdala,and striatum were detected,as well as the activation of astrocytes and the expression of phagocytosis receptors.Methods:(1)A mouse model of chronic stress was established by chronic restraint stress(CRS)method,and 16 SD rats were randomly divided into control group and chronic restraint stress group;(2)The GC content of cerebrospinal fluid and plasma was detected by ELISA method;(3)The open field experiment was used to detect the autonomous behavior,exploration behavior and tension of rats,the Morris water maze experiment was used to detect the spatial learning and memory ability of rats,and the object recognition experiment was used to evaluate the learning and memory ability of rats by detecting the length of exploration time of familiar old and new objects;(4)q PCR,Western Blot and immunofluorescence were used to detect the expression of prefrontal cortex,hippocampus,amygdala,striatal synaptic structural protein,MEGF10 and MERTK,and the density of dendritic spines was observed with sparse marker virus brain stereotactic injection.Results:(1)CRS rats had significantly increased plasma and cerebrospinal fluid corticosterone levels and decreased body weight;(2)CRS caused cognitive impairment in rats,which was manifested as impaired spatial learning and memory ability,impaired general learning and memory ability,decreased self-inquiry ability,and emotional anxiety;(3)The dendritic spinous density of the hippocampus of CRS rats decreased,the expression of prefrontal cortex,hippocampal synaptic structural proteins PSD95,GAP43 and SYP decreased,and Aβ deposition increased;(4)A1 type activation occurred in the prefrontal cortex and hippocampal astrocytes,the level of MERTK increased,and the level of MEGF10 remained unchanged.Conclusion:(1)Chronic restraint stress led to cognitive impairment in rats,decreased dendritic spines in prefrontal cortex and hippocampal neurons,synaptic structure damage,and Aβ deposition;(2)Astrocyte activation and increased MERTK levels in rats under chronic restraint stress may be related to the above changes;(3)Amygdala,striatal neurons,and astrocytes do not have the above changes,which may not be related to the occurrence of cognitive impairment.Chapter 2.MERTK plays a role in stress-induced cognitive impairmentObjective: To verify whether cognitive dysfunction and neuronal pathological changes under chronic stress are related to astrocytes activation and increased MERTK expression by downregulating MERTK expression to flip cognitive dysfunction and neuronal pathological changes.Methods:(1)Four groups of models were established by r AAV-sh Mertk hippocampal stereotactic injection,Ctrl+GFP,Ctrl+sh Mertk,CRS+GFP,CRS+sh Mertk.(2)ELISA method was used to detect the GC content of cerebrospinal fluid and plasma in rats;(3)The learning and memory ability of animals was evaluated by using open field,Morris water maze and object recognition experiments;(4)q PCR,WB,immunofluorescence methods were used to detect the dendritic spinous density,synaptic structural protein changes,and the expression of astrocyte activation and phagocytosis receptor MERTK.(5)Three-dimensional reconstruction of phagocytosis synaptic structural proteins in hippocampal astrocytes by fluorescence confocal scanning in threedimensional reconstruction.Results: Compared with the stress group,r AAV-sh Mertk stereotactic injection of hippocampal brain with the interference sequence GGAAGAAATCAAGCCAGATCA could effectively reduce the expression of hippocampal astrocytes Mertk,reduce the phagocytic synaptic structure of hippocampal astrocytes,and invert CRS-induced cognitive dysfunction and neuronal pathological changes.Conclusion: Chronic binding stress leads to cognitive impairment,decreased dendritic spines in hippocampal neurons,synaptic structure damage,and Aβ deposition,which are closely related to astrocytes activation,increased MERTK level,and enhanced phagocytosis.Chapter 3.Molecular mechanisms of stress-induced abnormal phagocytosis in astrocytesObjective: To establish a stress cell model,explore the possible mechanism of GC elevation of Mertk,and study the role of MERTK in the phagocytic function of astrocytes.Methods:(1)Mouse cerebellar astrocyte line C8-D1 A was intervened with GC at different concentrations and times in vitro to establish a suitable stress cell model;(2)by querying the UCSC gene database,NCBI and JASPAR gene database,looking for possible binding sites between GC and Mertk promoters;(3)The predicted binding efficiency and enrichment factor of GRE(GC binding element)were verified by chromatin co-precipitation(4)MERTK function was inhibited,and the changes of C8-D1 A phagocytosis Aβ in vitro were observed.Results:(1)100μM 4h GC intervention in astrocytes,Mertk elevated level was the highest,Megf10 expression level remained unchanged;(2)RU486 intervened in the stress cell model,and the level of Mertk decreased;(3)The ratio of enrichment rate to enrichment efficiency between the experimental group and the negative control group was less than 8,and GRE was not in the 2000 bp promoter region upstream of Mertk;(4)After UNC2250 intervenes in astrocytes,its ability to phagocytose Aβ in vitro is weakened.Conclusions:(1)GC increases Mertk through glucocorticoid receptor(GR)and its genomic effects;(2)glucocorticoid-binding elements(GRE)located outside the 2kb region of the upstream promoter of the Mertk gene,or GC indirectly upregulates Mertk expression in some way;(3)Astrocytes exert phagocytosis through the active form of MERTK,p-MERTEK,and can effectively engulf Aβ protein in vitro.
Keywords/Search Tags:Chronic Restraint Stress(CRS), Astrocytes, Cognitive Dysfunction, MERTK, MEGF10, rAAV, shMertk, Cognitive dysfunction, Phagocytosis, RU486, GRE, UNC2250, p-MERTK
Related items