PRL-3 Regulates RhoA Activity And MDia To Promote Cell Migration And Invasion In Lung Cancer Cell

IntroductionPRL-3(phosphatase of regenerating liver-3)as a new member of PTP family,has become accepted as an intriguing group of protein being validated as biomarkers and therapeutic targets.In the last few years,evidence has accumulated for the association of PRL-3 with oncogenic states and several indications have linked its expression to human colon cancer progression and metastasis.In order to elucidate the role of PRL-3 in lung cancer progression,in our early research we have investigated PRL-3 expression in tumor and adjacent normal tissues from 94 non-small cell lung cancer (NSCLC)patients,and further correlated PRL-3 expression with clinical and pathological prognostic factors as well as with the surgical treatment outcome.In this study,the expression of PRL-3 in the non small cell lung cancer cell lines and human bronchial epithelial cell line were investigated.The effects of endogenous PRL-3 on the A549 cell invasion and the activity of RhoA which is a regulator of motility and invasion were studied via small interfering RNA(siRNA)technology.Meterial and Methods1.Cells and reagentsHBE(Normal human bronchial epithelial cells),A549(pulmonary adenocarcinoma cell)NCI-H661,NCI-H460(pulmonary large carcinoma cell) SK-MES-1(pulmonary Squamous Carcinoma cell).Anti-PRL-3,anti-RhoA antibody(Santa Cruz),anti-mDial antibody(BD Biosciences),RT-PCR Kit(Takara), Lipofectamine^TM2000(Invitrogen),PRL-3 siRNA was given by Beverly A Teicher of Genzyme Company(Xeragon/Qiagen;target sequence: TGAGAGCGGGATGAAGTACGA;siRNA Negative-1,Ambion),RhoA activity assay using G-LISA^TMRhoA Activation Assay Biochem Kit(Luminometry Based) from Cytoskeleton.2.Cell cultureThe cell line used in this study such as A549 cell were cultured in the Dulbcco's Modifed Eagle Medium(DMEM)or RPMI-1640 containing 10%or 15%FBS(Gibco, USA),100U/mLpenicillin,and 100U/mL streptomycin at 37℃with 5%CO2 until 75%confluent.A549 ceils were exposed to 100ng/mL anti-RhoA antibody or anti-mDia antibody in serum-free Dulbcco's Modifed Eagle Medium(DMEM)for 24 hours.3.PRL-3 siRNA TransfectionThe cells(5×10⁴ per well)were plated in a 24-well plate in medium without antibiotics 24 hours before transfection.All transfections were carried out in triplicate. The protocol for siRNA transfection in a 24-well format(Invitrogen)was followed for all transfections.The general procedure is as follows:(a)siRNA(20 pmol;1μL of a 20μmol/L solution)was added to 50μL DMEM I reduced serum medium,(b) Lipofectamine^TM2000(1μL)was added to 50μL DMEM I reduced serum medium and incubated for 5 minutes at room temperature,(c)The siRNA and Lipofectamine were mixed and incubated at room temperature for 20 minutes,and(d)The 100μL mixture was added to the cells.4.Reverse Transcription-Polymerase Chain Reaction(RT-PCR)Total RNA was isolated from cells in the logarithmic growth phase using TRIZOL (Invitrogen).Follow the instruction of RT-PCR Kit(TaKaRa).Primers for PRL-3: 5'-GGGACTTCTCAGGTCGTGTC-3',R:5'-AGCCCCGTACTTCTTCAGGT-3';β-actin F:5'-AAATCGTGCGTGACATTAA-3',R:5'-CTCGTCATACTCCTGCTTG -3'5.Immunofluorescence stainingThe cells grown on coverslips were fixed with 4%paraformaldehyde followed by 0.2%Triton X-100,PBS washing,and blocking with nonimmune animal sera at 37℃for 30 min.The cells were incubated with primary antibodies at 4℃overnight, followed by incubation with FITC-labeled secondary antibodies washing with PBS,or the cells were only incubated with Phalloidin-TRITC(SIGMA)10μg/mL for 30min, then incubation with DAPI at 37℃for 30 min,washing with PBS,mounting with 50% glycerine,and observation under a fluorescence microscope.6.Western blottingThe cells were extracted with lysis buffer for lh or 24 h at 4℃.The supernatants were centrifuged at 12000×g for 30 min at 4℃.The supernatant containing total protein was harvested.Aliquots containing 60μg of proteins were separated on a 12% SDS-polyacrylamide gel and transferred to PVDF membranes.The membranes were blocked with 5%skimmed milk,respectively incubated with anti-PRL-3,anti-mDia and anti-β-actin(1:200,Santa Cruz,USA)at 4℃overnight,and followed by each corresponding second antibody(1:2500,Chemicon,USA)at room temperature for 2 h. Next,DAB visualization and then densitometric analysis of the bands was performed.7.In vitro cell growth assays10³ cells in 200μL of medium were plated in a 96-well plate and incubated for 24 h,48 h,72 h.20μL of 5 mg/mL MTT(3-[4,5-2-y1]-2,5-diphenyltetrazolium bromide; Sigma,USA)was added to each well.After a 4 h incubation,the medium containing MTT was removed and replaced with 150μL of dimethyl sulfoxide(DMSO,Sigma)for further incubation for 10min till the formazan was dissolved.The OD value of each well was measured using a microplate reader(SPECTRA Thermo,USA)with a test wavelength of 490 nm.The wells containing only the medium were used as controls. The proliferation curve was plotted.8.Cell migration and invasion assays5×10⁴ cells were harvested with trypsin,washed,resuspended in serum-free DMEM,and added to the upper chamber.The lower chamber contained 10%FBS as a chemoattractant.The chambers were incubated at 37℃,5%CO2 for 6 h,followed by washing with PBS,and fixing in 100%methanol,stained with Hematoxylin, photographed,and counted.For the invasion ability assay,precooled serum-free DMEM was mixed with Matrigel(BD Biosciences,USA)(1:7 dilution).The upper chambers were filled with 100μL of mixture,and the Matrigel was allowed to solidify at room temperature for 3 h.Other procedures followed the migration protocol(BD Biosciences,USA).The chambers were incubated for 18 h.9.Rho activity assaysAccording to the instructions for G-LISA^TMRhoA Activation Assay Biochem Kit (BK121,Cytoskeleton),the protein of A549 cells exposed to PRL-3 siRNA 72 h post-transfection were extracted,the concentrations of proteins were measured,G-LISA method was used to detect the protein.The OD value of each well was measured using a microplate reader with a test wavelength of 490 nm.10.Statistical analysisThe statistical package SPSS13.0(SPSS incorporated,Chicago)was used for all analyses.Analysis of statistical significance was done using t tests for assays consisting of two experimental sample groups.The ANOVA test and Tukey-Kramer post hoc test were used to determine statistical significance in assays consisting of more than two experimental sample groups.Results1.The HBE cell line had low levels of PRL-3 mRNA.All three neuroblastoma cell lines expressed relatively high levels of PRL-3 mRNA,especially the A549 cell line.2.Immunostaining showing the PRL-3 protein in Human Bronchial Epithelial Cells and A549 cells.In A549 cells PRL-3 localize in the cytoplasm,and are excluded from the nucleus,but in Human Bronchial Epithelial Cells PRL-3 localize in the nucleus.3.Western blot and RT-PCR analysis showing PRL-3 protein levels and mRNA decreased in A549 cells exposed to PRL-3 siRNA 72 h post-transfection.4.The results of the MTT assay showed that downregulation of PRL-3 did not affect A549 cell proliferation.5.Transwell and cell motility test showing cells number decreased significantly exposed to PRL-3 siRNA.6.Levels of activate RhoA and mDia protein decreased significantly exposed to PRL-3 siRNA 72 h post-transfection.7.Blocking RhoA expression with anti-RhoA antibody leeding to down regulation of mDia protein levels and formation of F-actin cytoskeleton in A549 cells. Blocking mDia also led to the decrease of F-actin cytoskeleton formation.Conclusion1.Specific siRNA is able to reduce PRL-3 at both mRNA and protein levels and significantly diminishes the invasiveness of lung cancer cells.2.PRL-3 regulates RhoA activity and mDia to promote cell migration and invasion in lung cancer cell via influencing the formation of F-actin cytoskeleton.