Font Size: a A A

Study Of Association Between Intercellular Adhesion Molecule-1 Gene Polymorphism And Risk Of Colorectal Cancer

Posted on:2010-09-18Degree:MasterType:Thesis
Country:ChinaCandidate:Y B LiuFull Text:PDF
GTID:2144360275469442Subject:Surgery
Abstract/Summary:PDF Full Text Request
Objective: Colorectal cancer(CRC) is one of the most common malignant tumors in our country. However,the mechanism of development of CRC is unclear.Intercellular adhesion molecule-1(ICAM-1) gene polymorphisms are present in human.The association between ICAM-1 gene polymorphis- ms and risk of CRC remains unknown.The aim of the present study is to investigate whether ICAM-1 gene polymorphisms (G241R and K469E) correlates with CRC in population of North China,and to provide valuable reference for risk of CRC.Methods:1 Specimens : 87 cases of CRC specimens and 102 controls were collected from patients operated in the Surgery Department of the Fourth Hospital of Hebei Medical University during December 2007 to June 2008. The genome DNA was extracted from the leukocytes.2 PCR sequence-specific primers(PCR-SSP): PCR-SSP were used for the detection of ICAM-1 genotypes in 87 patients with CRC and 102 controls. Primer sequences were as follows:Forward: 1: 5'GTG GTCTGTTCCCTGGACG3' (G241); 2: 5'GTGGTCTGTTCCCTGGACA3' (R241)。Reverse: 3: 5'GCACATTCACGGTCACCTC3' (E469); 4: 5'GCACATTCACGGTCACCTT3' (K469)。For the control GAPDH: Forward:GAAGGTGAAGGTCGGAGT; Reverse:GAAGATGGTGATGGGATTTC。Results:1 The G241R polymorphism was GG genotype in all of cases and controls.2 Relationship between ICAM-1 gene polymorphism (K469E) and clinical parameters.Among 87 patients, the positive rates of KK genotype in high and medium differentiated colorectal cancer was 53.2% (33/62), which was significantly higher than that in poor differentiated colorectal cancer 28.0% (7/25) (P<0.05). No significant correlations were found between the ICAM-1 polymorphism and gender, age, tumor location, metastasis, and Dukes stages.3 The relationship between K469E polymorphisms and CRCThe frequencies of KK,KE and EE genotypes of K469E polymorphism were 55.5 % and 44.7%, 38.9% and 46.1%,5.7% and 9.2%,patients and controls, respectively. The frequence of KK genotype in CRC patients was significantly higher than that in controls (P<0.05),and the relative risk sufferd from CRC of KK genotype was 1.54 times of the KE+EE genotypes (OR=1.54, 95%CI:1.05~2.27). The frequency of the K allele was significantly higher in the CRC patients than that in controls (χ2=4.194,p=0.041, OR=1.58,95%CI:1.02~2.46).Conclusion:1 There is not G241R polymorphism of ICAM-1 gene in Chinese.2 The K469E polymorphism of ICAM-1 gene is positively correlated with the risk of CRC.3 KK genotype is significantly associated to differentiation degree of CRC.
Keywords/Search Tags:colorectal cancer, intercellular adhesion molecule-1, single nucleotide polymorphisms, allele, PCR-SSP
PDF Full Text Request
Related items