In order to give effective molecular markers for the marker-assisted selection (MAS) on early production performance of chickens, the systematic investigation was conducted on Jinghai yellow chicken breed, including the early growth rule and different expression of correlated gene, SNP polymorphism of E-FABP and Ghrelin gene, population genetic diversity, and the relationship between molecular markers and correlation characteristics. The early growth rule was studied with three curve models, canonical correlation analysis and principal component analysis, and the gene differential expression in the brain and small intestine tissues of three growth periods was detected with DDRT-PCR method, the polymorphism and relationship between polymorphism and growth and carcass characteristics were analyzed by PCR-SSCP(PCR-RFLP) and microsatellite marker techniques.The results were as follows:(1) The average weight of male and female was 1849.57 g and 1444.49 g respectively at the age of 16 weeks. Logistic, Gompertz and Bertalanffy model can fit the growth very well,and the values of R2 were all exceed 99%, but integrated analysis showed that the Bertalanffy model was the best to this breed. Results by canonical correlation analysis showed that the significant correlation between weight at the age of 16 and 12 weeks and shank length, between weight at the age of 16 and 12 weeks and dressing weight, between body length, shank length and semi-eviserated weight reflected the essential relationship of three characteristics. Results by principal component analysis indicted that the first 5 principal components reflected the information of the carcass characteristic from the original data as much as possible.(2) The GTPase activating protein played an important role during the growth and development period of chickling as a type of activating factor.(3) Five genotypes of AA, CC, AB, AC and BC with primer P1 (P99) of E-FABP genes were detected, genotype BB was not found, the allele frequency of A, B and C allele were 0.45, 0.10 and 0.45 respectively. With primer P95 (P98), results showed three genotypes of DD, DE and EE, and the allele frequency of D and E allele was 0.61 and 0.39 respectively. The gene frequencies and genotype frequencies both reached the Hardy-Weinberg equilibrium at those two loci indicated by theχ2 test. With primer P74, three genotypes ofâ… ,â…¡andâ…¢were detected, and the allele frequency was 0.71, 0.09, and 0.21 respectively. Through sequencing alignment, results showed that there was"CTTAAATTTTCCTTACATTC"20bp absence on the site of 4269-4288bp with primer P1 (P99) of E-FABP gene, A conversion to G on the site of 4015bp with primer P95 (P98), and G conversion to A on the site of 2187bp, T changed to C on the site of 2268bp and 2342bp respectively, T changed to A on the site of 2273bp with primer P74.(4) Six genotypes of AA, BB, CC, AB, BC and AC were detected with primer P1 of Ghrelin gene, the allele frequency of A, B and C allele was 0.36, 0.48 and 0.16 respectively; three genotypes of DD, EE and DE were detected with primer P3, the allele frequency of D and E allele was 0.81, 0.19 respectively. The gene frequencies and genotype frequencies were both fit Hardy-Weinberg equilibrium at those two loci. Two genotypes of FF and FG were found with primer P5, and GG genotype was absent. Allele frequency of F and G allele was 0.96 and 0.04 respectively. Through sequencing alignment, for BB genotype, there was"TC"2bp absence on the site of 73bp relative to AA genotype, and for CC genotype,"CTAACCTG"8bp absence on the site of 79bp with primer P1; T changed to A was detected on the site of 546bp with primer P3, and T changed to C on the site of 1274bp with primer P5.(5) Those SNPs of E-FABP and Ghrelin gene had important effect on the growth and carcass characteristics in Jinghai yellow chicken breed, and could be used to MAS as molecular markers of correlation characteristics.(6) For Jinghai yellow chicken breed, the average of H (Heterozygosity) and PIC (Polymorphism Information Content) were 0.32 and 0.59 respectively, and the values of D were below 0 among all the loci, which showed that heterozygosity was under theory value. The genetic diversity was comparatively abundant and there was much space for selection though the breed had been bred for 7 generations.(7) Those loci of ADL136, ADL185, MCW0058, MCW0328 and MCW120 had significant or highly significant effect on the growth and carcass characteristics, which would be used for early selection and MAS in Jinghai yellow chicken breed.
|