Single Nucleotide Polymorphism Of E-FABP Gene Associated With Correlated Traits In Jinghai Yellow Chicken

Fatty acid binding proteins(FABPs) is a family of small (14-15kDa) cytosolic non-enzymatic proteins.They are believed to participate in the metabolism of long chain unsaturated free fatty acids.Epithelial fatty acid-binding protein(E-FABP)is a member of the fatty acid-binding proteins.E-FABP also known as psoriasis-associated fatty acid–binding protein(PA-FABP), keratimocyte FABP or DA11 was firsted recognized as a psoriasis-associated FABP. It is highly expressed in psoriatic epidermis,in different cancer entities and was domonstrated to promote metastasis formation.This study was to detect the polymorphisms of E-FABP genes in Jinghai yellow chickens by DNA sequencing and PCR-SSCP methods. The SNPs were detected with population genetic methods. Meanwhile, the correlation between different chicken genetypes and the productive traits were investigated.The main results were as follows:(1) In Jinghai yellow chicken five genotypes (AA,CC,AB,AC,BC) were detected with primer P1( P99) of E-FABP.The gene frequencies for allele A, B and C were 0.4468, 0.0993 and 0.4539, respectively. The results of PCR-SSCP showed that three genotypes(DD,DE,EE) were detected with primer P95(P98). The gene frequencies for allele D and E were 0.6099 and 0.3901.The chi-sequare test(χ2) showed that the distribution of genotypes of the primer P1(P99) and P95(P98) was not significant different(P>0.05)among population and the two SNP locis were in Hardy-weinberg Equilibrium status (HWE).Inaddition three genotype (Ⅰ,Ⅱ,Ⅲ) were detected with promer P74, the genotypic frequencies ofⅠ,Ⅱ,Ⅲwere 0.7092,0.0851 and 0.2057.(2) As for the result of sequence analysis of primer P74 four mutation sites in the E-FABP DNA sequence were found, which were 2187bp(G→A), 2268bp(T→C), 2273bp(T→A)and 2342bp(T→C). As for the result of sequence analysis of primer P95 (P98), one mutation (A→G) site at 4015bp of E-FABP DNA sequence was detected. And for the result of sequence analysis of primer P1(P99), there were twenty bases (CTTAAATTTTCCTTACATTC ) absent at 4269-4288bp of E-FABP DNA sequence.(3) Different genotypes determined by primers P1(P99) for E-FABP were remarkbly associated with the shank circumference and muscular stomach weight of Jinghai yellow chicken, and the differences between genotypes were extremely significant(P<0.01) and significant(P<0.05), respectively. Genotype AA showed the longest shank circumference,and genotype BC were the shortest. Genotype AB had the biggest muscular stomach weight.(4) Different genotypes determined by primers P95(P98) for E-FABP had significant influence on body weight, body size and carcass traits of Jinghai yellow chicken. In a word, the genotype DE was better than genotype DD and EE in many traits.(5) The associations with carcass traits including abdominal fat weight and breast muscle rate were observed significant between different genotypes determined by primers P74 for E-FABP (P<0.2); and both breast muscle weight and spleen weight (P<0.05); also the abdominal fat(P<0.01). The genotypeⅢof either rooster or hen showed better than genotypesⅠa ndⅡin breast muscle weight, breast muscle rate and spleen weight. Both weight and rate of abdominal fat in genotypeⅡwere bigger than that in genotypesⅠ( P<0.05) and genotypeⅢ.Different genotypes determined by primers P1(P99) and P95(P98) for E-FABP had important influence on growth traits and productive performances according to this study, which indicated that they might be used as molecular makers of MAS for growth traits and productive performances of chicken.