The Relationship Of Human DNA Repair Gene Polymorphism With Breast Cancer

DNA repair maintains the integrity of the human genome by reducing the mutation frequency of cancer related genes. The removal or repair of DNA damage has a key role in protecting the genome of the cell from the insults of cancer - causing agents. A deficiency in DNA damage repair is associated with an increased cancer risk. Considerable progress has been made in identifying genes in human cells that determine DNA repair pathway, especially nucleotide excision repair ( NER) , double stranded DNA break repair ( DSBR) and single strand break repair (SSBR)..Hereditary genetic defects in DNA repair lead to increased risk of cancer. Exposure to ionizing radiation (IR) has been linked to cancers of the thyroid, breast and lung as well as leukemia. Sin oxidative nucleotide damage and strand breaks induced by IR are repaired mainly by NER. Variations between individuals in DNA repair capacity occur in human and may be a risk factor for cancer. Individuals with xeroderma pigmentosum ( XP) resulting from a defect in NER of UV - damaged DNA, have a > 1000 fold increased risk of skin cancer. XRCC3 is a member of Rad51 DNA repair gene family; it functions in the DSBR, which plays important roles in maintaining genome stability. XRCC3 mutant cells show moderate by persensitivity to IR, UV and monofunctional alkylat-ing agents. XRCC1 plays an important role in SSBR and participates as a scaffolding intermediate by interacting with ligase III (ligIII) and DNA polymerase B (polB). The human XRCC1 gene has been identified by its ability to restore DNA repair activity in the Chinese hamster ovary (CHO) mutant cell line EM9.Individuals with genetic variation resulting in loss of functionality for breast cancer genes have a risk of cancer approaching unity. To support future studies that address the role of genetic variation at the genes of DNA repair in breast cancer susceptibility, we have initiated an effort to screen DNA repair genes for DNA sequence variation We have selected three DNA repair genes, representing three different repair pathways.- nucleotide excision repair, double stranded DNA break repair and single strand break repair. The single strand conformation polymorphism ( SSCP) assays has been used to detect the polymorphism of XPD, XRCC3 and XRCCL To find if specific polymorphisms in DNA repair genes can be identify that correlate with a breast cancer susceptibility pheno-type. Our experiment consisted of three parts as follows; 1. XPD polymorphism and breast cancer. 2. XRCC3 polymorphism and breast cancer. 3. XRCC1 polymorphism and breast cancer.Materials1. Main Apparatus; MJ PCR Gene Ampthermocycler, high speed centrifuge, spectrophotometry, ABI PRI SM377 DNA Sequencer, stable temperature water bath.2. Main Reagent: RPMI media, Fetal bovine serum, Trypsin EDTA, QIAAMP DNA Kit, QIAquick PCR Purification Kit, Ampli Taq Gold, lOmMdNTP Mix, lOObp DNA Ladder, Ulter water, TEMED, 32P - dCTP, 50 x TAE buffer, 5 xTBE buffer, 10% APS, MDE gel solution, DNA Star software.Methods1. Study subject: 30 breast cancer cell lines; 100 high - risk breast cancer family women; 100 no -high risk breast cancer family women.2. Cell culture and genomic DNA predation: Cells were placed in 37℃ incubator and add trypsin to resuspend the cells and add new media. Cells can be split when they are 85 -100% confluent. The womenS blood were separated inCPT tube, and got the lymphocytes. Genomic DNA was extracted using QIAAMP DNA Kit3. PCR amplification conditions; The PCR primers were designed from DNA gene bank in intron or non - coding regions.XPD (exon 23) : fw: 5 TCAAACATAATGTCCCTACTRev: 3'CTGCGATTAAAGGCTGTGGA XRCC3 ( exon 7 ) : fw: 5'GGTCGAGTGACAGTCCAAACRev: 3'CTACCCGCAGGAGCCGGAGG XRCC1 (exon 10): fw: 5'GGGCATCTTCACTTCTGRev: 3 'CTCCAGCCTTTGGATAAGand were radiolabeled by 32P dCTP. PCR was completed with 100ng in a volume of 12ul using a thermal cycler. Amplification conditions were 94℃ for 10min; amplify 94℃ 20 sec, touchdown 68 -63...