The major role of microsomal ethanol oxidizing system (MEOS ) in hepatic is found in ethanol metabolism, which focuses on its constitutive, ethanol- inducible cytochrome P-450 2E1(CYP2E1). CYP2E1 is shown to play a key role in the hepatotoxicity of ethanol and that of other xenobiotics. CYP2E1 can also be induced by many endogenous substances, for example, corticosteroid, ketones, free fatty acid, and affected by some pathophysiological conditions such as starvation, diabetes, obesity, alcoholic fatty liver disease (AFLD) and nonalcoholic fatty liver disease (NAFLD). The regulation of CYP2Elexpression is complex, involving transcriptional and posttranscriptional events. Some studies show that trace amounts of ethanol induce the increase of protein level and activity, and heavy drinking induces the increase of mRNA level. Constitutively over expressed CYP2E1 generates a state of oxidative stress in hepatocytes associated with elevated lipid peroxidation. It injureshepatic tissue and results in inflammation, fibrosis and carcinogenesis. CYP2E1 is capable of generating reactive oxygen intermediates, such as superoxide radicals and the known toxicity of these free oxygen radical species. CYP2E1 plays a key role in the pathogenesis of liver injury. The pathology of the liver in alcoholic steatosis and alcoholic steatohepatitis (ASH) is remarkably similar to that of nonalcoholic fatty liver disease (NAFLD), including nonalcoholic steatohepatitis (NASH), and suggesting some common pathogenic mechanism. In addition, CYP2E1 is associated with an increased incidence of upper alimentary and respiratory tract cancers by activating procarcinogens, and with drug-induced liver disease by toxication.In view of the pathogenic role of CYP2E1 in both ASH and NASH, inhibitors are being considered to oppose the up-regulation of CYP2E1 activity by either ethanol, fatty acids or ketones, which result in increased generation of reactive radicals and toxic metabolites. Indeed, it has been suggested that CYP2E1 inhibitors may eventually provide useful tools for the prevention and treatment of the hepatotoxicity associated with heavy drinking as well as overeating. The author of this thesis wants to find a method to restrain CYP2E1 gene transcription, and to inhibit its activity. Until recently, functional inhibition in biological system has been induced by means of a variety of approaches including small molecule antagonists, antibodies, aptamers, ribozymes, antisense oligonucleotides or transcripts, morpholinos, dominant-negative mutants, and knockout transgenic animals. Although all of these approaches have made substantial advances in our understanding of the function of many proteins, a lack of specificity or restricted applicability has limited their utility. Recently,exploitation of the naturally occurring posttranscriptional gene silencing mechanism triggered by double-stranded RNA (dsRNA), that is, RNA interference (RNAi), has gained much favor as an alternative means for analyzing gene function. Aspects of the basic biology of RNAi, its application as a functional genomics tool, and its potential as a therapeutic approach have been extensively reviewed. The author attempts to control the expression of CYP2E1 gene by RNA interference, and observes the effect of reducing the toxicity of inducer. The technologic flow chart of the project, which is composed of three parts, is showed below.devising the point of RNA interference of CYP2E1 cDNA sequence obtaining siRNA expression cassettes from PCR, expressing siRNA in cell, controlling CYP2E1 gene transcription, and screening the optimal point from four candidate oligosrecombining the plasmid for the optimal point to express the siRNA of CYP 2E1 genesiRNA coming from shRNA controls CYP2E1 gene to steadily express in E47 cell and instantaneously express in Hep G2 cell.oxidative stress E47cell inducerCell injury(steadily expressed CYP 2E1) (apoptosis )Picture 1: The technologic flow chart of the projectPart one: controlling the transcription of CYP450 2E1 by siRNA expression cassettes to screen the optimal point of RNA interferencemethods1. Downloading the whole cDNA sequence (gi: 45768591) of human CYP2E1 gene from MEDLINE—Pubmed, and selecting the four target points according to the method of Tuschl's (588—606, 975—993, 1233—1251, 1263—1281) .2. The PCR downstream primer for the four candidate points was devised to produce antisense transcripted template for RNAi, sequence of which was 5' -caaaaactgtaaaaa GN17C ggtgtttcgtcctttccacaaga -3', and to produce sense transcripted template for RNAi, sequence of which was 5' - caaaaactgtaaaaarc GN17C ggtgttt cgtcctttccacaaga -3' according to the direction of LineSilence? RNAi Transcription Kit.3. Using upstream primer, the template provided by LineSilence? RNAi Transcription Kit and the downstream template devised for CYP2E1 had a PCR.4. PCR product transfected cell after purification.5. RT-PCR detected the level of CYP2E1 gene transcription to screen the optimal point from four candidate oligos.Results1. Resuscitated E47 cell grew well, and density of cell was 0.5—2X105 per 0.5 ml culture medium.2. pIRES-EGFP (invitrogene) and PCR product transfected E47 cell by Lipofectamine 2000 at the same time. The GFP in cell was observed, which acted as asuccessful sign of transfection after 24h.3. There were 8 pieces of electrophoresis strap produced by PCR to express siRNA in vivo. Having transfected cell, four corresponding sense and antisense chains were expressed to form dsRNA in cell.4. The effect of expression cassettes to produce siRNA for controlling CYP2E1 transcription showed: the lighteness of CYP2E1 electrophoresis strip was lower than the lighteness of control. The effective RNAi was demonstrated, and point 1233~ 1251 was optimal.Part two: Reconstructing a plasmid of optimal point to produce siRNA of CYP2E1 gene and observing the effect of RNAi in different cells.Methods1. Designing a siRNA expression plasmid to produce shRNA of CYP2E1 in cell, 5' end and 3' end of oligos contained EcoR I were cut and Hind III cut respectively, in order to connect with vector BS/U6.2. siRNA might be produced from a single plasmid harboring an insert that produced siRNA in a constructed hairpin format. For siRNA insert, two complementary synthetic DNA oligos were needed. The sense was designed to be 5' -AATTCgccagaacacttcctgaatTTCAAGCAAattcaggaagtgttctggcTTTTTA -3% antisense to be 5'-AGCTTAAAAAgccagaacacttcctgaatTTGCTTGAAattcaggaagtgtt ctggcG-3', which contained five T's in downstream sense, and a 9-nucleotide linker region in the middle.Plasmid BS/U6 came from a PCR product which used Plasmid pmU6 (+315/-1) as a template to get an isolation of the U6 promoter (+315/-1), which was cloned into Bluescript (BS) to generate the parent plasmids.The coding sequences of optimal point for siRNA was 5'-gccagaaeac ttcctgaat-3', which was screened by the above method. It was designed to insert Plasmid BS/U6.After annealing of the two DNA oligos, it was subcloned into EcoR I and Hind III was cut of the intermediate plasmid to generate BS/U6/CYP 2E1. Another control plasmid was designed as the above, but coding sequences was thrown into confusion randomly. It was named BS/U6/CYP 2E1-C.3. Number 2 clone and DH 5 a of pSilenCircle/P53 were resuscitated and cultivated to a manifold and picked-up plasmid.4. BS/U6/CYP2E1, BS/U6/CYP2E1-C and pSilenCircle/P53 were transfected to E47 cell by Lipofectamine 2000. BS/U6/CYP2E1 and pSilenCircle /P53 were transfected to HepG2 together. As part one, pIRES-EGFP was a sign of successful transcription.5. Detecting the level of CYP2E1 gene transcription and setting inner control: The level of CYP2E1 gene was detected by RT -PCR, PCR product of CYP2E1 was 289 bp (542 — 830). Upstream primer was 5'-CGTCATAGCCGACATCCT-3\ downstream primer was 5'-CTCCATTTCCACGAGCAG-3\ The temperature of annealing was 54°C. Inner control wasl3 -actin. Upstream primer was 5'-CCAAGG CCAACCGCGAGAAGATGA-3', downstream primer was 5'-AGGGTACATGGTGGTGCCGCCAGA -3'. PCR product was 587 bp. The temperature of annealing was 54°C.6. The electrophoresis strip of 2 H 1 PCR product was taken a picture and relative quantity of CYP2E1 and 0 -actin calculated by a system of glue image and software.Results1. Number 1, 2, 3, 4, 5 and 20 clones were selected from 28 clones, and had a PCR by M13 primers. Number 3, 5 and 20 clones got segments of 550 bp, and number 2 and 4 clones got segments of 600 bp, which demonstrated a successful insert.2. Measuring the sequence to make sure the correctness of the two clones.3. Observing the effective RNA interference of BS/U6/CYP2E1 and (BS/U6/CYP2E1-C) in E47 cell.(DThere was no electrophoresis strip of CYP2E1 PCR product, but there was an electrophoresis strip of P53 PCR product in C34 cell. It showed C34 cell did not transcript CYP2E1.(2)The electrophoresis strip of CYP2E1 PCR product of E47 cell which had been trancripted by BS/U6/CYP2E1 was lower in lighteness than that which had been not trancripted by BS/U6/CYP2E1, but the electrophoresis strip of CYP2E1 PCR product of the E47 which had been transcripted by BS/U6/CYP2E1-C was as light as that which had been not trancripted by BS/U6/CYP2E1-C. It showed BS/U6/CYP2E1 could result in an effective RNAi but BS/U6/CYP2E1- C could not.(3) Both electrophoresis strips of CYP2E1 and P53 PCR product of E47 cellwhich had been transfected by BS/U6/CYP2E1 and pSilenCircle/P53 vector were lower in lightness than that which had not been transcripted by S/U6/CYP2E1 and pSilenCircle/P53 vector together. But the electrophoresis strips of CYP2E1 and P53 PCR product of E47 cell which had been transcripted by pSilenCircle/P53 vector and BS/U6/CYP2E1 vector respectively were as light as that of their respective control, and that which had been transcripted by BS/U6/CYP2E1 vector and pSilenCircle /P53 vector respectively were lower than that of their respective control. It showed the RNAi had specialties4. The siRNA expressed in Hep G2 by BS/U6/CYP2E1 vector could restrain the instantaneous transcription of pREP9-CYP2El.5. 1 I 10 of pREP9/CYP 2E1 and BS/U6/CYP2E1 simultaneous transfection had the best effect on RNAi.Part three: Observing the change of cell injury from CYP2E1 inducer after gene silence by RNA interferenceMethods1. Number 2 clone was resuscitated and cultivated to a manifold and picked-up plasmid.2. BS/U6/CYP2E1 vector transcripted E47 cell by Lipofectamine 2000. pIRES-EGFP signaled a successful transcription during the process.3. The E47 cell which had and had not transcripted by BS/U6/CYP2E1 vector was induced by 0.8% ethanol, 30 u mol/L fish oil, 30 u mol/L palmitic acid and 0.8%ethanol plus 30 u mol/L fish oil respectively. The cell and culture medium were collected after 48h. Cell was frozen and melted 3 times. Every condition was repeated 5 times. The protein, malondialdehyde (MDA) and Glutathione (GSH) of cell and culture medium were detected according to the direction of product.4.1 X PBS washed the glass piece of E47 cell, which was dyed by 4 u 1 AO/EB fluorescent dye liquid (100 u g/ml) diluted by 100 u 1X PBS. The morphologic change of cell volume decreased , cellular nucleus shrank, nucleus broke up or became lune and apoptosis body (Councilman body) was observed by fluorescent microscope at once. The rate of apoptosis was calculated.5. Detecting the level of CYP2E1 gene transcription and setting inner control: The level of CYP2E1 gene was detected by RT -PCR, PCR product of CYP2E1 was 289 bp (542—830), Upstream primer was 5'-CGTCATAGCCGACATCCT- 3', downstream primer was 5'-CTCCATTTCCACGAGCAG-3'. The temperature of annealing was 54 °C. Inner control was P -actin. Upstream primer was 5'-CCAAGG CCAACCGCGAGAAGATGA-3', downstream primer was 5' -AGGGTACATGGT GGTGCCGCCAGA-3'. PCR product was 587 bp, The temperature of annealing was 54 °C.6. Statistical analysis: the SPSS Statistical Package program was used for all analyses. The quantity of MAD in culture medium and cell, of GSH in cell, and rate of apoptosis were displayed by (X±S) . The association between the variable was tested by Student's t test and relativity analysis. P<0.05 was deemed significant.Results1. The shapes of E47 cell changed when they were induced by 0.8% ethanol, 30 U mol/L fish oil, 30 u mol/L palmitic acid and 0.8% ethanol plus 30 u mol/L fish oil respectively, especially when the cell was induced by fish oil and ethanol plus fish oil. It demonstrated unsaturating fatty acid had stronger toxicity than saturating fatty acid.2. When they were not treated by RNA interference, the rates of the lighteness of electrophoresis strip of E47 cell CYP2E1/ £ -actin which had been reduced by ethanol (1.07), fish oil (1.16) , palmitic acid (0.87), and ethanol plus fish oil (1.15) were higher than those of control (0.41); When treated by RNA interference, the rates of the lighteness of electrophoresis strip of E47 cell CYP2E1/ P -actin which had been reduced by ethanol (0.89), fish oil (0.91), palmitic acid (0.44), and ethanol plus fish oil (0.79) were higher than those of control (0.21) too, but the latter was lower than the former.3. Comparing what had been treated with what had not been treated by RNA interference when CYP2E2 was induced by ethanol, fish oil, palmitic acid and ethanol plus fish oil. The oxidative stress of E47 cell took place. Reactive oxygen species(ROS) —MAD in cell and culture medium which had been treated by RNAi were less than those which had not been treated by RNAi, P<0.01.4. No matter treated by RNAi or not treated by RNAi, when E47 cell was induced by ethanol, fish oil, palmitic acid and ethanol plus fish oil, the oxidative stress of E47 cell took place. Antioxidant— GSH was depleted, but the former is less severe than the latter.? 5. There was relationship between MDA and GSH, r=-0.82, P<0.01.6. When induced by ethanoL fish oil, palmitic acid and ethanol plus fish oil, the rate of apoptosis E47 cell which had not treated by RNAi was higher than that which had been treated by RNAi, P<0.01.7. There was relationship between the rate of apoptosis cell and the level of MAD,r=-0.82, P<0.05.Conclusion1. Four siRNA target points and the designed sequences by using CYP2E1 were successful.2. The target point (1233—1251) had an optimal effect on RNAi.3. It is a facilitating, convenient, and cheap method to screen the optimal point of RNAi by expression cassettes.4. The method has not been reported by other domestic papers. We have provided a good method for studying of RNAi in other genes.5. BS/U6/CYP2E1— a reconstruction vector made by us could result in effective RNAi of CYP2E1 in cell, and it was unique. The expression of siRNA reconstruction vector of CYP2E1 had a good effect, no matter in E47 cell which steadily expressed CYP2E1 or in Hep G2 cell which instantaneously expressed CYP2E1.6. The expression of siRNA reconstruction vector of CYP2E1 has provided a good tool for us to study CYP2E1 gene. The work is advanced because it is the first time for it to be reported at home and abroad. Having been induced by ethanol and fatty acid, the transcription level of CYP2E1 gene rose. At the same time the level ofMAD, a kind of ROS , rose and the level of antioxidant GSH fell. It demonstrates CYP2E1 is important in pathogenesis of AFLD AND NAFLD.7. The level of transcription of CYP2E1 gene rose and apoptosis of cell was severe when it was induced by ethanol and fatty acid. It demonstrated that during the cell injury of AFLD and NAFLD, the high expression of CYP2E1 gene and happening of oxidative stress resulted in activation of sign conduction and apoptosis.8. The function of unsaturating fatty acid was stronger than that of saturating fatty acid in the process of fatty acid's arousing CYP2E1 transcription.9. The siRNA control CYP2E1 gene transcription in cell could decrease the aggravation of oxidative stress and cell injury.10. Restraining CYP2E1 gene expression by RNAi to prevent the cell from being injured by oxidative stress and to decrease the apoptosis of cell has not been reported at home and abroad. The study result has demonstrated the method is highly efficient, facilitating, convenient and controllable. It is an originality to treat AFLD, NAFLD, PHC and drug-induced liver disease.
|