Hepatoma is the most common tumor, the incidence is high in our country,About 42.5â„… cases in the world take place in China.The feature of hapatoma isshort course, fast evolve, high fatality. For this reason, investigation work offundament and prevention for hepatoma is imminently.N-ras is a member of ras family, activation of N-ras main take place in thetumor of hepar and hematopoietic system. Hepatoma can high express N-ras gene.Ras is a membrane-bound GTP/GDP protein that severs as a "molecularswitch ",coverting singals from the cell membrane to the nucleus. P21 encodedby N-ras is a regulatory protein of GTP/GDP .Activation of P21 can promotetumor cell cleavage, induce tumor cell migration and invasion, and induce tumorvessel formation. N-ras mRNA concentration is very low and even can not bedetected in normal tissues.but N-ras mRNA concentration is very high incorresponding cancer cell. Therefore, the ras-signaling pathway has attractedconsiderable attention as a target for anticancer therapy because of its importantrole in carcinogenesis.Many researchers tried to inhibit ras expression by antisense oligonucleotidesand ribozyme, which has low transduction efficiency and transient workingtime .RNA interference (RNAi) technique emergence provides a new way toinhibit gene expression. Proposed by Fire et al in 1998, RNAi is the posttranscription gene silence induced by dsRNA, which can slience gene specificallyand result in gene functional reduction or incapacitation. RNAi technology hashigh specificity and efficient compared with antisensenuclric acids. RNAi hasspecificity, persistence and sensitivity, and its' applications in genome medicine,gene therapy, gene function study, mechanisms of gene expression regulationstudy are more and more extensive.The purpose of this experiment is to inhibit N-ras expression by RNAitechnique mediated by liposome in hepatoma carcinoma cells Bel-7402, inhibittumor cell proliferation and induce tumor cell apoptosis, and explore new way forhepatoma gene therapy.This experiment devised shRNA with transfection human hepatomacarcinoma cells by liposome mediate method, detect N-ras gene expression inRNA level and protein level with RT-PCR and Western Blot , detect cellproliferation condition that have transfected cells with MTT, detect apoptosis with flowcytometry.Results demonstrate: hepatoma carcinoma cells were transfected withPsilencer11-u6-N-ras-2-shRNA, the expression of N-ras mRNA and protein wassuppressed;cell proliferation was suppressed;apoptosis was indentified in thetransfected hepatoma carcinoma cells. However, hepatoma carcinoma cells weretransfected with Psilencer11-u6-N-ras-1-shRNA, the expression of N-ras mRNAand protein was not suppressed;apoptosis was not indentified in the transfectedhepatoma carcinoma cells. We can conclusion: N-ras-2 sequence(AAGACCAGACAGGGTGTTGAA) is effective RNA interference sequencethat inhibits N-ras gene expression in humen hepatoma carcinoma cells Bel-7402,but N-ras-1 sequence (GTGCCATGAGAGACCAATA) is not effective RNAinterference sequence.The innovations of this experiment are summarized as follows: investigatingexpression of N-ras by RNAi technology for the first time;discovering that shorthairpin RNA targeted on N-ras can inhibit expression of N-ras in hepatomacarcinoma cells and induce apoptosis for the first time;discovering that N-ras-2sequence can inhibit N-ras gene expression and suppress cell proliferation inhepatoma carcinoma cells Bel-7402 for the first time.To sum up, our future work is to inhibit hepatoma carcinoma cellsproliferation and induce apoptosis further by multiple combination RNAistrategy, we hope to develop gene therapy medicine that inhibits hepatomacarcinoma cells proliferation and induce apoptosis specifically and effectively.
|