Effect Of Leptin On Insulin Synthesis, Secretion And The Pathway Of Signal Transduction

Part 1 Expression and Distribution of the Functional Leptin Receptor mRNAObjective Leptin receptor is a recently identified hormonal product, encoded by the diabetic(db) gene.The Leptin Receptor has several alternatively spliced variants. One of these spliced variants is expressed at a high level in hypothalamus and is believed to be the functional receptor(OB-Rb).Leptin receptor widely distributed in choroid, hypothalamus, testes, and so on.Whether or not leptin receptor distributed in pancreas is disputed. Tartaglia, Emilsson believed that leptin receptor distributed in pancreas, but Murakami did not think so. we would approach and demonstrate it further.Methods All the tissues were obtained from fifteen 4-to 6-week old male C57/BL6(+/+) mice. The RNA expression level of leptin receptor was revealed by immunohistochemistry and RT-PCR.RNA was isolated using Trizol kit. Polymerase chain reaction (PCR) amplification (30 cycles)of a 0.302kb fragment of OB-Rb was performed with a sense primer(SS 5'-- AGAATTGTTCCTGGGCACAAG, AS 5' --ACACTCATCCTCACAGGTTCC) and an antisense primer by ampli-Taq(95℃60s denaturation;55℃60s annealing;72℃ 60s extension). Leptin receptor was examined with agarose gel electrophoresis at last.Results Leptin receptor is expressed in C57/BL6 mouse in Hypothalamus, pancreas, heart, liver,kidney,Fat and so on.Conclusions Leptin Receptor was not only expressed in heart, liver, kidney, fat, spleen, Hypothalamus, But also expressed in pancreas in C57/BL6 mouse. So we could demonstrate that its ob and db gene have no mutation.Part 2 Effect of pouring leptin into SD rates on insulin secretionObjective: In order to observe the effect of pouring leptin into SD rates on insulin secretion.Methods: 144 male Sprague-Dawley rats, 6 weeks of age (average weighing-200g), were used for the experiment. Among these, all rats was divided into 2 groups (a group that underwent vagotomy, a group that underwent both vagotomy and i.v. glucose load) were used for pre-experiment, which is in order to find out the obvious effectual concentration of leptin to the insulin secretion. All rats, which underwent catheterrization of the femoral vein, were divided into 6 groups (an intact, a group that underwent vagotomy, a group that underwent both vagotomy and chemical sympathectomy, a group that was subjected to an i.v. glucose load, a group that underwent both vagotomy and i.v. glucose load, a group that underwent vagotomy and chemical sympathectomy and i.v. glucose load). Rats from each group received a bolus injection of leptin (10nmol/kg) or a control PBS or an i.v. glucose load.Afterward, artrial blood was withdrawn at 0, 3, 6 and 30min for the determination of plasma insulin levels.Result: There is no significant effect by leptin on plasma insulin in intact rats and both vagotomy and chemical sympathectomy. Leptin significantly suppressed an increase in plasma insulin concentration in vagotomized rats, especially i.v. glucose load.Conclusion: Leptin suppressed insulin secretion through activation of the sympathectic nervous system. There is a close relation between leptin and insulin.Part 3 Effect of leptin on glucose-stimulated insulin secretion in the incubating isolated isletsObjective: In order to observe the effect of leptin on glucose-stimulated insulin secretion in incubating isolated islets.Methods: Sprague-Dawley rats (250g-350g) were obtained and islets were isolated from excised pancreata of rats by collagenase digestion. Islets were incubated in one incubation medium for 2 hours and pre-incubated in the other medium for 1 hour. Then groups of 10 islets were put in the holes. 22 holes were divided into two groups of 11 holes each. One group was put in leptin (10mM) and glucose of 11 different concentrations (4mM-24mM), and the other group was put in PBS and glucose of 11 different concentrations (4mM-24mM). After static incubation for 2 hours, insulin was assayed in the supernatant by radioimmunoassay (RIA). According to the result, another 22 holes were obtained to observe the effect of leptin of 22 different concentrations (0-1000ng/ml) on insulin secretion. Each hole was put in glucose (12mM) and leptin of one concentration. After static incubation for 30 min, insulin was assayed in the supernatant by RIA.Result: leptin (10mM) inhibited insulin secretion stimulated by glucose of different concentrations in incubating isolated islets, especially at the glucose concentration of 12mM. Leptin (0-1000ng/ml) demonstrated a U-shaped dose-response inhibition of insulin secretion stimulated by glucose (12mM) in incubating isolated islets. Conclusion: leptin inhibited insulin secretion stimulated by glucose of different concentrations in incubating isolated islets. Leptin of different concentrations demonstrated a U-shaped dose-response inhibition of insulin secretion in incubating isolated islets.Part 4 Leptin inhibits expression of preproinsulin mRNA in ratsObjective The effect of leptin on expression of preproinsulin mRNA in rats under different conditions were studied in this paper.Methods In vitro, isolated rat islets from noninjected were incubated in the absence or presence of recombinant rat leptin(100ng/ml) for 2 h or 24 h at either 5.6mM or 20mM glucose; in vivo, islets were isolated from leptin-injected or PBS-injected rats. The levels of preproinsulin mRNA were measured by RT-PCR. Results ①leptin did not change preproinsulin mRNA levels at normal glucose concentration. ②preproinsulin mRNA was not inhibited by leptin at 2 h at glucose concentrations of 20mM. ③leptin reduced preproinsulin mRNA at 24 h and 20mM glucose concentration.Conclusion ①leptin inhibits insulin synthesis in rat islets directly. ②leptin resulted in a time-dependent decrease in preproinsulin mRNA levels. ③There is a glucose-dependent inhibition of preproinsulin gene expression by leptin.Part 5 The effect of leptin on the pathway of signal transduction after insulin receptorObjective: The effect of leptin on the pathway of signal transduction after insulin receptor was studied in this paper.Methods: Islet cells were cultured to confluence of monolayer, pre-incubated 16h with 0, 4, 10, 12mM leptin after grouping, then acute stimulated 1min by 12mM leptin. Cells without leptin were defined control group. The levels of tyrosine phosphorylation of TRB, TRS21, IRS22 and interaction between IRS21/22 and P85 were assayed by immunoprecipitation. Optical density of immunoreaction line were assayed with software of Image Quant, and transformed to relatively percentage of group one.Results: The levels of tyrosine phosphorylation of signal molecule were lowed in basal state. The tyrosine phosphorylation of TRB, IRS-1 and IRS-2 were initiated with acute stimulation of 1min by 12mM leptin. There was no significance in levels of protein expression in group 1. Cells were incubated 16h with 0,4,10,12mM leptin. The tyrosine phosphorylation of TRB, IRS-1 and IRS-2 were reduced along with concentration increasing of leptin. The levels of tyrosine phosphorylation of TRB, IRS-1 and IRS-2 were lowest in the condition of 12mM leptin. No difference with above, conjugation reaction of IRS-1 and P85 was decreased as well as that of IRS-2 and P85 after disposal of leptin The levels of protein expression of IRB, IRS-1, IRS-2 and PI3K were decreased.Conclusion: The pathway of signal transcription after insulin receptor can be affect by leptin through PI3K pathway.