Study Of Tumor-associated Autoantibody And RASSF1A SNP For High-risk Subject Screening And Early Detection Of Esophageal And Gastric Cardia Cancer

1 BACKGROUNDLinzhou City(formerly Linxian County)in Henan Province has been well known asthe highest incidence area for esophageal squamous cell carcinorma(SCC) and gastriccardia adenocarcinoma(GCA) in China, as well as in the world. SCC and GCA remainthe leading cause of cancer-related death in this area. The prognosis for SCC and GCAat late stages is very poor, with a 5 year survive rate of around 10%. But there are aboutover 90% of SCC and GCA at early stage could survive 5years. However, because of nospecific symptoms for the early sufferer, more than 90% SCC and GCA are in middleor advanced stages when diagnosed at the first time in clinic. Lacking of biomarkers forhigh-risk subject screening and early detection for SCC and GCA is the leading causefor the late diagnosis and high level of mortality for these disease. Apparently, it iscrucial to elucidate the molecular mechanism of esophageal and gastric cardiamult-stage carcinogenesis, to identify the key related proteins and genes, to establish thebiomarkers for high-risk subject screening and early diagnosis.So far, endoscopic biopsy and histopathological examination through mass surveyand follow-up in high incidence area remain one of the most effective strategies to discover early cancer and precancerous lesions. However, it is expensive, timeconsuming, uncomfortable and is limited in large scale mass survey for symptom-freesubjects from high incidence area. Recent studies by us and other groups have showed:(1) Many abnormal protein expressions occured during SCC and GCA multi-stagecarcinogenesis, the changes of p53-Rb pathway are the most frequent molecule events;(2) These molecule events have been detected more frequently with thepre-cancerous lesion progressed; (3) The autoantibodies of theseproteins(tumor-associated antigens, TAAs) could be detected in blood serum atmulti-stage carcinogenesis of the esophageal and gastric cardia epithelia; (4) Theautoantibodies of these proteins are related to the molecule events changes in the tissue.The results of the research show that the autoantibodies may be important molecularbiomarkers for high-risk subjects screening and early detection. Thus, the present studywas undertaken at Linzhou, the highest incidence area for EC in Henan, northern Chinaand to determine the possibility for high-risk subjects screening and early diagnosis forSCC and GCA with autoantibody measurement.In addition, recent studies have showed that methylation of Ras association domainfamily 1A gene(RASSFIA) and single nucleotide polymorphism(SNP) may play animportant role in breast and lung cancer carcinogenesis. The malignant transformationrate of breast and lung precancerous lesions with RASSF1A methylation is significantlyhigher than that without RASSF1A changed. The latest data of human haplotype planindicates that RASSF1A polymorphic site (Ala133 Ser) is present in Chinese population.Our hypothesis is that SCC and GAC may have similar hereditary factor involved, andautogenous variation of RASSF1A may increase the susceptibility to SCC and GAC.However, the relationship between RASSF1A (Ala133 Ser) gene SNP and thesusceptibility to SCC and GCA is largely unknown in the high incidence area for SCCand GCA in Henan province. Thus, this study was designed to determine therelationship between RASSFIA (Ala133 Ser) SNP and the susceptibility to SCC andGCA on the subjects from high incidence area in Henan, and to provide more molecularbasis and methods for screening high risk subjects. 2 MATERIALS AND METHODS2.1 SubjectsTotal 863 symptom-free subjects were enrolled in this study, including 284 males and578 females with a mean age of 55±11. Epidemiology investigation was performed withthe help from the local village cadres and local clinical doctors. For allowed person,there were the inquiries of their medical records and medical examination, and fillingout of the questionnaire which included tumor history of their family members. All thesubjects had no diseases such as acute infection, hypersensitive diseases, autoimmunedisease that might affect the expression of serum protein. 112 SCC surgical specimenwere collected, including 68 male with a mean age 57±10 and 44 female with a meanage 59±10. 116 GCA specimen were collected, including 70 male with a mean age55±10 and 46 female with a mean age 60±10. All the patients were from EC and GCAin Linzhou EC Hospital during 2000 to 2005.2.2 Study design2.2.1 Autoantibody measurement was performed on the symptom-free subjects inLinzhou, the high incidence area. The subjects with positive autoantibody test wouldfurther undergo endoscopic, biopsy, pathologic histology and immunohistochemistryexamination to confirm the esophageal and gastric cardia lesions. The similar number ofsubjects with autoantibody negative was also performed similar examination.2.2.2 Cross-check analysis was carried out in the application value and significance oftumor correlated autoantibody detection for early discovery of EC and precaution ofhigh risk group.2.2.3 DNA was extracted from the SCC and GCA pathology sample in Linzhouesophageal carcinoma hospital, Henan province, and was genotyped for RASSF1A(Ala133 Ser) SNP.2.2.4 DNA was extracted from the symptom-free inhabitant in the areas with highestincidence of esophageal and gastric cardia cancers in Linzhou, Henan province, whichwas genotyped for RASSF1A (Ala133 Ser) SNP as control.2.2.5 Cross-check analysis was carried out in the relationship between RASSF1A (Ala133 Ser) gene SNP and the susceptibility to SCC and GCA.2.3 Methods2.3.1 Blood samples collection and processingFive ml of fasting venous blood from each subject was collected into centrifuge tubein the studying field. Sera and blood clot were separated and stored in -80℃for furtheruse.2.3.2 Blood serum autoantibody testThe antigens for C-myc, cyclinB1, IMP1, Koc, p16, p53, p62 and Survivin wereextracted and purified by American Scripps Research Institute. Indirect enzyme—linkedimmunosorbent assay, ELISA was used to detect the autoantibody in the serum samples.The final diluted concentration of all coating antigens was 0.5μg/μl. The concentrationsfor serum and anti-human IgG conjugated in ELISA were 1:50, 1:5000, respectively.Each sample was repeated at least twice.2.3.3 Predication of Blood serum autoantibody testEach sample was repeated at least twice. ELISA results were evaluated based on thevalue of mean±3SD.2.3.4 Endoscopic and biopsy examinationsIn the 8 autoantibodies by serology detection, sbujects with at least 1 autoantibodypositive and those with autoantibody negative matched roughly in similar number wereaccepted endoscopy and biopsy examination. 1～2 pieces of biopsy tissue wereobtained routinely at the middle 1/3 of the esophagus (30cm～32cm from cutting tooth),the lower 1/3 of the esophagus (above 2cm～3cm of the borderline of esophagus andcardia) and gastic cardia (2cm～3cm below the Z-line at the gastroesophageal junction).Extra biopy was obtained randomly at the sites with macroscopic changes, iodinestaining was undertaken at the mucous membrane of esophagus and methylene bluestain in cardia when necessary, then tissue was taken at the non-stained area of theesophagus and stained area of the gastic cardia. All of the biopsy tissues were fixed with95% alcohol quickly. Paraffin imbedding was carried out after routine dehydration, then5μm for the thickness of each piece of the 9 serial sections, with 1 piece for HE stain toverify the histopathologic diagnosis, and the other 8 for immunohistochemistry examination.2.3.5 Histopathological and immunohistochemistry examinationBased on the epithelial cell morphology, tissue architecture and cell differentiation,the esophageal epithelia were classified as normal(NOR), basal cell hyperplasia(BCH),dysplasia (DYS), carcinoma in situ (CIS) and squamous cell carcinoma (SCC); gastriccardiac adenocarcinoma (GCA).The positive staining (brown) was mainly located incytoplasm or nucleus. Five eye-fields under high power magnification (x40) wereexamined, and the number of positive cells=10% was considered as positive.2.3.6 Extraction of DNADNA was extrcted from peripheral blood of the symptom-free subjects with alcoholphenyl- chloroform method, dissolved in TE balanced solution, and reserved at -80℃.2.3.7 The volume of dropping polymerase chain reaction (PCR) was 25μl, whichincluded: 1μl for genome DNA, dNTP(10mmol/L respectively), 10xbalanced solution,5pmol for primer respectively, 1U for Ex Taq DNA pclymerase, and the above reagentwere products of TaKaRa company. Circulation parameter of dropping PCR: 5 minutesfor pre-degeneration at 94℃; 94℃30s, 64℃(-0.3℃/circulation) 30s, 72℃30s, with16 circulations together; 30s for degeneration at 94℃, 40s for off fire at 56℃, 72℃extension 40s, with 20 circulations together; and finally, 10min for extension at 72℃,then reserved at 4℃. The above reactions was undertaken on the GeneAmp PCR system9700 gene amplifier (PE application biological system company, Amerincan).2.3.8 Genotyping analysisReference sequence was chr3-50342222-50353371, and primer design used primer3software. Two pairs of primer were designed with nest PCR, with lateral primer: p1ATGATTCTGTCTTTCCCTTATCCA and p2 ACCAAACCTTGATAATAGGTTCCA;and interior primer: p1 AAGGCAGTCAGTTTCCAAAGACT and p2ATGAAGAGGTTGCTGTTGATCTG. The first PCR used lateral primer, and theproduction was diluted to 100 as second PCR model after amplification. 10μl PCRproduction was taken out with restriction enzyme (NEB company), then aqueous bathedat 37℃overnight. Products cut by enzyme used gel electrophoresis with 3% agaroseand electrophoresis results were analyzed by gel imaging analysator. RASSF1A extron 3 encoded the codon of 133rd amino acids, which is GCT (Ala) or TCT (Ser), and itssequence was enzyme cutting site of restriction enzyme AluI when the site wasallelomorphic gene G. The end product of net PCR was 227bp, and including itspolymorphic site in which. When the PCR products was digested by AluI, Ala/Alagenotype were two straps of 169bp and 58bp, Ala/Ser genotype was three straps of227bp, 169bp and 58bp, Ser/Ser genotype was one strap of 227bp for unable to cut out.2.3.9 Homologization analysisRASSF1A protein sequence of rat, mice, dog, troglodyte, rhesus monkey and humanwas compared with Clustw procedure, and protein sequence search came fromPUBMED, with serial numobrs were: XP₈50255 (Canis familiaris, dog);XP₀01168270 (Pan troglodytes, troglodyte); NP₀01032644 (Rattus norvegicus,rat); AAK21200 (Musmusculus, mice); XP 001100583 (Macaca mulatta, rhesusmonkey); NP₀09113 (Homo sapiens, human) respctively.2.4 Statistics analysisThe x² test, matched-pairs chi-square test and Spearman Correlation test in SPSS(13.0 version) were used for the ELISA and immunohistochemistry analysis. Fisherexact x² test was carded out to detect whether the genotype distribution of the controlgroup corresponded with Hardy-Weinberg balance, so as to judge whether deviation ofgenotype distribution or allelic distribution existed and thus determine its representationfor the whole crowd. As for the estimation and analysis of risk, "case ofdisease-control" test design was used with non-conditional logistic regression model tocalculate odds ratio (OR) and 95%Confidential Intervals, CI. SPSS13.0 statisticssoftware was used. (P＜0.05 was considered significant).3 RESULTS3. 1 The situation of tumour epidemiologyAmong the 863 subjects who accepted the investigation of tumour epidemiology,There were 242 peoples whose immediate relatives had kinds of tumours,(28%), 621peoples had no tumor medical records during the three generations immediaterelatives(72%).There were totally 384 tumor patients with their family tumor medical records. Among them,298 patients were suffered from SCC, (78%), 35 patients were sufferedfrom GCA, which covered(9%), 51 patients were found with other kinds of cancers.227 SCC cases (91%) were found in clinic in the middle or advanced stages.3.2 Multiple sera autoantibody detection391 symptom-free subjects were tested with multiple sera autoantibody detection,and the autoantibody level of 8 tumor associated antigen in serum (C-myc,cyclinB1,IMP1,Koc,p16,p53,p62,Survivin) were detected. Totally there were 79 cases withat least one positive antibody of the 8 tumor associated antigen detected. In all grades ofesophageal lesions, IMP1 and p53 was the highest among 8 antigens in serum whichwere 5.6% and 4.9% respectively, followed by C-myc (4.4%) and p62 (2.3%).However, combining antibodies combined together and there was 20% that at least oneantibody was positive for analysis, we found that the antibody frequency tended toincrease stepwise with the lesion grades increasing (P＜0.01), which increased 2-8 foldsthan any single positive antibody.3.3 Endoscopy and biopsyTotally there were 64 cases with at least one positive antibody and 67 cases withnegative accepting the endoscopy examination. Result showed that the ratio of normalesophagus with autoantibody positive was significantly lower than that of negtive (P＜0.01).With the heavier pathological changes pre-cancer, among C-myc,cyclinB1,IMP1,Koc,p16,p53,p62 and Survivin, there was at least one antibody tested positive tendedto increase, and showed multi- autoantibody positive. Among 131 cases tested fromendoscope, 54 cases were with normal esophagus, 44 cases were found with basal cellhyperplasia, 30 cases with dysplasia. Besides, 2 cases with early EC were found, whichwere all in the positive autoantibody group. From the autoantibody negative group, onecase was found with GCA.3.4 ImmunohistochemistryTwo sets of each 10 samples with NOR, BCH, DYS and 2 samples of SCC, one setwith positive autoantibody and another set with negative were detected byimmunohistochemistry with 8 antibodies(C-myc, cyclinB1, IMP1, Koc, p16, p53, p62 and Survivin). 40 samples of serum antibody positive were found in 62 patients withdifferent type of esophageal disease, 77 samples of protein expression positive in tissue,which showed that the ratio of protein expression positive in tissue was significantlyhigher than that of autoantibody positive in serum (P＜0.05)3.5 RASSF1A (Ala133 Ser) SNPThe sex and age was similar in SCC, GCA and control groups (P＞0.05). All thesamples used genotype typing successfully, and all the repeated results were consistent.The distribution of RASSF1A (Ala133 Ser) genotype correspond with Hardy-Weinbergbalance (P=0.831).3.6 The relationship between RASSF1A (Ala133 Ser) SNP and SCC and GCAsusceptibilityThere was no significant difference between SCC group and control group for Ala/Ala,Ala / Ser and Ser / Ser genotypic frequency of RASSF1A (Ala133 Ser) SNP (P=0.96), but significant difference existed between GCA and control group (P=0.022).Comparing with Ala / Ala genotype, Ala / Ser and Ser / Ser genotype might increasethe risk (OR value=2.06, 95% CI=1.09～3.97). Delamination comparison reviewedthat heterozygote Ala / Ser inclined to increase the risk of GCA (OR value = 1.76, 95% CI=0.91～3.41), and homozygote Ser / Ser genotype might significantly increasethe risk of GCA (OR value= 9.01, 95 % CI =0.99～83.31).4 CONCLUSIONS4.1 The autoantibody of TAAs can be detected in the serum samples of symptom-freesubjects at high incidence of SCC.4.2 From the test, 2 early stage SCC cases were detected from autoantibody positivegroup. Contrast with the autoantibody negative group, we found that the incidence rateof precancerous change and cancer in the esophageal epithelial tissue with autoantibodypositive group was significantly higher (P＜0.01).4.3 The positive rates of 8 antigens in all grads of esophageal and gastric cardia lesionswere much higher than that of autoantibodies in serum from patients of matched lesions;the antibodies in sera from patients of SCC and GCA are positive and the matched antigens in tissue are also positive.4.4 According to the detection of serum autoantibody positive, can decrease surveysubjects for endoscope examination and increase detection rate of precancerous lesionand SCC in earlier period, which has some significance for precaution of high-risksubjects and early discovery in the area of high incidence of SCC.4.5 There was no significant difference between SCC group and control group in Ala/Ala, Ala / Ser and Ser / Ser genotypic frequency of RASSF1A (Ala133 Ser) SNP (P=0.96), but significant difference existed between GCA group and control group (P＜0.05). Heterozygote Ala / Ser was inclined to increase the onset risk of GCA (OR =1.76, 95% CI = 0.91～3.41), and homozygote Ser / Ser genotype might increase thesensitivity of GCA (OR=9.01, 95% CI = 0.99～83.31).4.6 From this epidemiology investigation, we found that SCC is still the highestincidence malignancy in this area.