Study On Horizontal Gene Transfer And Relationships Between Populations Of Parasitic Herb Cynomorium Songaricum RUPR

Cynomorium songaricum Rupr. is a very important herb which is widely used in Chinese medicine and Mongolian medicine. Cynomorium has two species: Cynomorium songaricum Rupr. which mainly distributes in China, Mongolia and Central Asia, Cynomorium coccineum Linn. which mainly distributes in North Africa and Mediterranean areas. There are debates about the taxonomy of Cynomorium, and the plant closely related to Cynomorium is still not found. Horizontal gene transfer (HGT) is an important way of evolution, and it includes important information about plant evolution. The HGT usually happens between parasitic plant and its host plant. Two species of Cynomorium are both parasitic plants and have many host plants, wether there are HGTs between Cynomorium and their host plants is still unclear. C. songaricum in China distributes in northwest desart area, the genetic diversity, chemical relationships and the active ingredient content of C. songaricum in different populations still need to be further clarified. This manuscript starts from the evolution process of Cynomorium, the phylogeny analysis were applied to analyze the taxonomy of Cynomorium; the HGT analysis was applied to analyze the evolution and replacement process of the host plants. ISSR markers and HPLC-fingerprinting were used to evaluate the relationships between different populations. The result showed:1. Accoding to phylogeny of Cynomorium and other38genera of angiosperms based on nuclear genes18SrDNA and26SrDNA, and morphological characteristics of Cynomorium, Cynomorium was in Santalales.2. Phylogeny analysis was also used to study the HGT of the mitochondrial gene atpl, coxl and matR between C. songaricum and its host plant Nitraria tangutorum Bobr.. The result showed there are HGTs of atpl between the common ancestor of Cynomorium and a common ancestor of Sapindales. A chemeric character was found in atpl gene of C. songaricum, a604bp fragment in atpl of C. songaricum showed higher similarity to N. tangutorum than to C. coccineum. The result indicates afer the divergence of C. songaricum and C. coccineum, the HGT still happens between C. songaricum and N. tangutorum.3. Based on the atpl gene sequence of C. songaricum which differed a lot from corresponding sequences in other plants, two primers (primer1:ggagatgggattgcacatgt, primer2:ccgcagacttgtttcattac) were designed, the result showed that they can effectively distinguish C. songaricum from Cistanche deserticola Y. C. Ma, Orobanche pycnostachya and Orobanche caerulescens Steph..4. Orthogonal design was used to optimize the ISSR-PCR reaction system of C. songaricum, the function of some addition agent was also disscussed. Genentic diversity of16populations in Northwest China were analyzed using inter-simple sequence repeat (ISSR) markers.The result showed that Shannon’s information index of C. songaricum populations showed remarkable genetic diversity in different populations, ranged from0.1422to0.3140. Nei’s genetic diversity index ranged from0.0931to0.2055. The coefficient of gene differentiation (Gst) was0.4925and the number of migrants per generation (Nm)was0.5151.5. HPLC fingerprinting was used to analyze the chemical relationship of16C. songaricum populations in Northwest China.16populations were classified into four chemotypes according to HPLC-fingerprinting analysis based on14stable peaks. Total phenolic acids contents were determined by Folin-Ciocalteu method, total phenolic acids contents ranged from56.79to123.50mg/g in16C. songaricum populations. 6. The results of the ISSR, HPLC fingerprinting and total phenol content of C. songaricum populations are used to suggest a planting and conservation system for C. songaricum. In each chemotype, locations where high genetic homogeneity and high active ingredients contents populations grow would be good candidates for building planting base. Nature reserve conservation zone should be built where high genetic diversity population grows. According to the analysis, Hanggin in Ordos, Hanggin Houqi in Bayan Nur, Alxa Youqi in Alxa of Inner Mongolia, and Suzhou in Wuwei of Gansu province were good candidates for building planting base. Guazhou in Jiuquan of Gansu province is good candidates for nature reserve conservation zone.