Molecular Typing Of Treponema Pallidum In Shandong, China

Background: Syphilis is a chronic classic sexually transmitted disease that caused by Treponema pallidum(TP). TP may invade the body organs(skin and mucous membranes, cardiovascular, neurological, skeletal, etc.), resulting in expressive syphilis,latent syphilis,late syphilis,spontaneous recovery,sero-resistance and recurrence after treatment. Since the 1990 s, it has been possible to investigate the molecular biology of syphilis due to the complete genome sequence determination of the Nichols strain. Since 1998, molecular characterization of TP has entailed analysis of 2 genes(arp,tpr) to CDC subtype. In 2010, Marra had developed an enhanced the of method strain- typing, which adding gene sequence types of p0548 gene to the existing CDC genotype systems. The enhanced molecular tying method for TP exhibits high discrimination potential. Many countries and regions have studied the genotyping of TP. So far there are no published data on the molecular typing of Treponema pallidum in Shandong, China. Therefore we collect 67 samples to looked for molecular typing in TP in Shandong, China.Objective: The aims of this study were to investigate DNA strain types of Treponema pallidum by analysis of three target genes in Shandong, China.Methods: 1.DNA was extracted from anogenital lesions presenting with syphilis, and was detected by a real-time polymerase chain reaction(PCR) assay. Positive samples amplify the arp/tpr/tp0548 genes by PCR. 2.(1) determination of the number of 60-bp repeats in the acidic repeat protein(arp) gene and(2)restriction fragment length polymorphism(RFLP) analysis of T.pallidum repeat(tpr) subfamily II genes.(3)sequence analysis of an 84-bp region of tp0548.Results: Suf?cient DNA for full molecular typing existed in 48 of 67 samples. A total of 6arp types(5,10,12,14,15 and18 repeats) and 7 tpr types(b,d,e,i,j,k and p) were identi?ed. For the sequence analysis of the tp0548 gene, types c and f were identi?ed.The majority of strains belonged to subtype 14d/f. According to the detected sequences, we found a new sequence of tp0548( CAGGCGGCAGTGGCCGCACGCGCTGGAGGGTCCGGCGGTAATGACAACCACCCCGGCAAG GAACAGTTTCTCCAGTT)which had never been reported before, and named it as type“k”. A new genotype of TP, 15j/k,was identified.Conclusion: Genetic diversity of TP was identi?ed in shandong province. We report a new sequence of tp0548 gene of TP and a new genotype of TP,which further expands the database of tp0548 gene sequence of TP and further expands our knowledge of the geographical distribution of TP strains. That will contribute to the study of molecular biology and epidimeology of TP, the association of syphilis and TP and sypuilis policymaking of treatment and prevention.