The Roles And Mechanisms Of Platelet Endothelial Cell Adhesion Molecule-1 In Septic Disseminated Intravascular Coagulation

Part ? Association of the plasma of soluble PECAM-1 levels and the occurrence and prognosis of septic DICObjective: To investigate the relationship between plasma concentrations of soluble platelet endothelial adhesion molecule(s PECAM-1)and occurrence and prognosis of septic DIC.Methods: Sixty-nine septic patients suspected with DIC and ten healthy volunteers were randomly selected from the DIC case library established by Wuhan Union Hospital.One portion of plasma of these corresponding subjects was randomly selected from the DIC plasma sample bank.According to the Chinese Society of Thrombosis and Hemostasis Scoring System,?7 points were diagnosed against DIC.Organ failure was defined as a Sequential Organ Failure Assessment score?2.The organ failure and 28-day mortality were the major tools assessing outcomes of patients.The concentrations of s PECAM-1 were measured by ELISA.Results: There was no significant difference in gender and age between the healthy controls and septic patients suspected with DIC.Among the 69 patients,24 individuals were diagnosed with DIC,23 patients had organ failure,and 16 patients died within 28 days.Compared with septic patients without DIC or normal controls,patients with septic DIC had markedly higher circulating plasma levels of s PECAM-1(p<0.05).Among the septic patients,s PECAM-1 levels were most pronounced in nonsurvivors and organ failure patients,compared with those survived or had no organ failure(p<0.05).Among the 24 DIC patients,14 patients died and the s PECAM-1 levels in these nonsurvivors were significantly higher than those survivors.The levels of s PECAM-1 had moderate correlations with the DIC scores reflected by Spearman correlation(0.401,p<0.05).ROC analysis demonstrated that the levels of s PECAM-1 were predictive for DIC development(AUC of 0.814,cut-off valve 16.69ng/m L)with high specificity(94.5%)and appropriate sensitivity(62.5%).Conclusion: Plasma levels of s PECAM-1 is closely corelated to the occurrence and prognosis of septic DIC,and it has a good diagnostic performance for septic DIC.Part ? Establishment and identification of PECAM-1 gene knockout mice using CRISPR / Cas9 technologyObjective: To generate and verify the PECAM-1 gene knockout C57BL/6 mice by CRISPR / Cas9 technology.Methods: According to the genomic structure and protein conserved region of PECAM-1,the protospacer adjacent motif(PAM)in the exon 3 sequence were searched,and the immediate upstream 20 nt of the PAM sequences were used as the candidate target sequences of CRISPR/Cas9.The corresponding pairs of sg RNA were designed according to the target sequences.Using Cas9-g RNA target efficiency detection kit,the g RNAs with the highest targeted cleavage efficiency were selected to be transcribed into RNA and injected into mouse fertilized eggs together with sp Cas91.1 protein.After birth,PCR agarose gel electrophoresis was used to analyze the genotype of mice,and the gel-cutting was recovered to perform gene sequencing.The expression of PECAM-1 at the protein level was verified by immunohistochemistry of liver tissues and western blot of spleen tissues.Under unstimulated condition,the behaviors of knockout mice and wild-type mice were observed,and some laboratory indicators were compared between the two kinds of mice,such as blood routine,coagulation screening tests as well as the function of liver and kidney and systemic levels of inflammatory cytokines.Results: Four CRISPR/Cas9 target sequences were designed based on PAM sequence in exon 3 of PECAM-1 gene.PECAM-1 g2(TCATGGGAGGTGATGAATGGG)had the highest targeted cleavage efficiency,close to 90%.Frameshift mutations of PECAM-1 occurred in one of the eight F0 mice because of 226 bases missing from a chromosome.In the subsequent reproduction process,heterozygote and heterozygote,heterozygote and homozygote as well as homozygote and homozygote could reproduce normally.The immunohistochemistry of liver tissue and western blot of spleen tissue showed no expression of PECAM-1 in knockout mice.Under physiological conditions,there was no significant difference in behavior between knockout mice and wild-type mice,and no significant differences were observed in blood routine,coagulation screening tests and function of liver and kidney as well as plasma levels of cytokines.Conclusion: The PECAM-1 knockout C57BL/6 mice were successfully constructed by CRISPR/Cas9 technology and verified at both gene and protein levels,laying the foundation for subsequent experiments.Part ? Exploration the role of PECAM-1 in septic DICObjective: To investigate the role of PECAM-1 in septic DIC.Methods: A single high-dose intraperitoneal injection of lipopolysaccharide(LPS,O111: B4,50 mg/kg)or cecal ligation and puncture(CLP)was used to simulate septic DIC in gender-and weight-matched PECAM-1 knockout(KO)and wildtype(WT)mice.Chimera were constructed by infusion of bone marrow mononuclear cells after systemic radiotherapy.According to the differences of donors and acceptors,chimera were divided into four groups: the donors and acceptors were both WT mice(WT-WT);the donors were WT mice,but the acceptors were KO mice(WT-KO);the donors were KO mice,but the acceptors were WT mice(KO-WT);the acceptors and donors were both KO mice(KOKO).Recipients were phenotyped by assessing the proportion of T lymphocytes expressing PECAM-1 in circulation using flow cytometry at 8 weeks post transplantation.At different time points after LPS challenge,the DIC related indicators,fibrin deposition in tissues as well as function of liver and kidney were detected.Plasma levels of soluble thrombomodulin(s TM),thrombin-antithrombin complex(TAT),and plasminogen activator inhibitor-1(PAI-1)were measured by ELISA.The expression of tissue factor(TF)in liver and the deposition of fibrin in tissues were detected by immunohistochemistry.Results: Without stimulation,no statistic differences were observed in DIC related parameters between WT and KO mice.After modeling,the count of platelets and activity of antithrombin ? decreased more significantly in KO mice(p <0.05);the increase in levels of fibrin degradation products,s TM,TAT,and PAI-1 elevated more obviously in KO mice(p <0.05);TF expression was more abundant in liver tissues of KO mice;fibrin deposition were more extensive in tissues of KO mice;the serum levels of creatinine and urea nitrogen were significantly higher in KO mice,compared with WT mice.In LPS-induced or CLPinduced septic DIC,the mortality of KO mice was significantly higher than WT mice,which could be effectively ameliorated by the TF inhibitor PCI-27483(p <0.05).The proportion of T lymphocytes expressing PECAM-1 in WT-WT,WT-KO,KO-WT,and KOKO mice was 96%,76%,24%,and 0%,respectively.At 6 h after LPS stimulation,the number of platelets declined in the following order,while this downward trend is accompanied by the opposite trend of increasing levels of s TM,TAT,and PAI-1: KO-KO > KO-WT ? WT-KO > WT-WT(p < 0.05).Similar trends were observed for the degree of fibrin deposition in tissues.Conclusion: PECAM-1 could protect mice against septic DIC and improve the outcome,which seems to be equally linked to PECAM-1 expression by both endothelial and blood cells.Part ? Mechanisms of PECAM-1 on inhibiting septic DICObjective: To explore the mechanisms of PECAM-1 inhibiting septic DIC.Methods: A single,high-dose intraperitoneal injection of LPS was used to simulate septic DIC.Blood and tissue samples were taken at different time points after modeling.The degrees of infiltration of neutrophils and macrophages in lung tissues were detected by immunohistochemistry.The levels of cytokines IL-6,TNF-a,MCP-1,and IL-10 were detected by Cytometric Beads Array,while IL-1? were measured by ELISA.The proportion of M1 and M2 peritoneal macrophages(PMs)were assessed by flow cytometry.Bone marrow derived macrophages(BMMs)were induced and cultured by granulocyte colony-stimulating factor.PMs and BMMs were given different stimulations(LPS,LPS transfected by Lipo3000 after LPS pre-stimulation,respectively;blank control,Lipo3000),then,the release ratios of LDH and IL-1? levels were measured,in addition to observing cell morphology under microscope.The PMs suffering pyroptosis were considered as those undergoing late apoptosis detected by flow cytometry.Evans blue experiments were used to evaluate the vascular barrier function.Results: Compared with WT mice,the infiltration of neutrophils and macrophages in lung increased more significantly in KO mice at 8 h after LPS challenge.After DIC modeling,the plasma levels of IL-6,TNF-a and MCP-1 in KO mice elevated more markedly(p<0.05),while anti-inflammatory cytokine IL-10 elevated more obviously in WT mice(p<0.05),indicating that the balance between pro-and anti-inflammatory was more severely disrupted in KO mice.M1 macrophage was the dominant type of macrophages in the peritoneal cavity of mice.When not stimulated,there was no significant difference in the proportion of M1 and M2 macrophages between WT and KO mice.However,KO mice had higher proportion of M1 macrophages at 8 h after LPS injection(p<0.05).Compared with WT-derived PMs and BMMs transfected by LPS,those from KO mice transfected by LPS released more proportion of LDH and more of them suffered pyroptosis(p<0.05).In addition,the plasma levels of IL-1? in KO mice were significantly higher than WT mice(p<0.05).After LPS stimulation,KO mice had more deposition of Evans blue in heart,liver,kidney,and lung tissues(p<0.05).Conclusion: its protective effect on developing septic DIC by the following two distinct mechanisms: the inhibition of macrophage pyroptosis and the acceleration of the restoration of the endothelial cell barrier.