Studies On The CDNA Isolation In The Gene Of Choline Monooxygenase (CMO) Gene From Populus Simonii

It is knowed that betaine is a kind of no poisonous osmotic solute, which is one of compound substance, and is existed extensively in cells of plant and animal, betaine is catalyzed on choline in plants. That is choline→betaine aldehyde→betaine.Between these two steps,the first step is the most important one that is up to the speed of catalyzed reaction.This article have the Populus simonii as materials that are taken from tongliao area of Northwest in China. After drought and water deficit for six weeks, Populus simoni material have showed responses to drought stress in a greatest degree in order to advance the plenty of mRNA., we collected the leaves of Populus simonii into liquid nitrogen. Then We extracted total RNA from plant leavies and countertranscripted total RNA into complement DNA by reverse transcriptase - polymerase chain reaction(RT-PCR). We designed out the 3' primer and 5' primer according to the sequence published in GenBank. 5'primer is : 5'GCATGGATTCATGGCAGCAAGGCAA3' ; 3'primer is :5'GCATGAATTCTACTTCAATTGTG3'. The dsDNA of has "A" base in 3' end was ligated to PGEM-T easy vector. Transformed into competence cell-DH5α Escherichia coli. Then screened the recombinant with α-complement experiment., Based on this, it was followed that choline monooxygenase(CMO) gene correlated with drought resistance had been isolated from populus simonii, successfully. According to sequencing result and the compare of homology in GenBank.it is showed that the length of the CMO gene is 821bp, and there are 75% homology with S.oleracea and 82 % homology with atriplex hortensix.