Studies On Genetic Diversity And Structure Of MtDNA Control Region Of Mystus Macropterus Bleeker

Mystus macropterus Bleeker which belongs to Siluriformes,Bagridae,Mystus Scopoli is one of the most commercial important freshwater fish in the Yangzi and the Zhujiang River.Presently, researches about the Mystus macropterus were mostly focued on the morphological anatomy, reproductive biology,domestication,nutriology and dynamics,there were few researches about the genetic relationship at the molecular level among the different populations of Mystus macropterus. Recently,along with water conservancy and hydropower project,such as Gezhou Dam and Three Gorges Dam,being constructed in the Yangzi River mainstream,more and more academicians focused on the genetic structure and genetic diversity of freshwater fish inside and out of the Three Gorges Reservior.It is worth researching whether all of these changes will influence the genetic structure and genetic diversity of Mystus macropterus.Thus,establishing a rapid,reliable and cost-effective estimation of genetic structure at the DNA level will be important in estimating the effects of there projects on the genetic structures of Mystus macropterus.In present study,random amplified polyrnorphie DNA(RAPD)analysis was used to estimate the genetic and relationship at DNA level among different the Yangzi River valley,such as Hechuan, Guangyuan,Yueyang and Jinkou.16 RAPD primers were used to assess genetic variation,there were 101 polymorphic genetic loci in 139 genetic loci,The proportion of polymorphic primer was 72.66%.Based on the RAPD data,the Shannon's information index of intra-population for Yueyang,Jinkou,Hechuan and guangyuan were 2.2237,1.9689,1.9356,1.0770.Nei's genetic diversity was in agreement with the Shannon's information index and showed that Yueyang population was the maximum,the Jinkou population followed,the minimum was the Guangyuan population(YY＞JK＞HC＞GY).The genetic distance revealed that the maximum genetic distance occurred between the Yueyang and Guangyuan populations(the number was 0.1015),the minimum genetic distance occurred between the Yueyang and Jinkou populations(the number was 0.2890).With the method of UPGMA on the basis of genetic diatance,the results showed the populations of Yueyuang and Jinkou assembled one branch first,the last did Guangyuan and Hechuan populations because of these populations's the different sites.Complete sequence of Mystus macropterus mtDNA control region is amplified and compared with sequence of Leiocassis longirostris,Pseudobagrus tenuis and Pelteobagrus nitidus downloaded from GenBank.In analogy,the conserved region of these three species are identified as extended terminal associated sequence,Certrol conserved sequence block,Conserved sequence block;The sequences of ETAS is TACATTAATGTGCTATGGTATAGT;The sequences of CSB-F is ATGTAGTAAGAAACCACCAACCCTCAAT,The sequences of CSB-E is AGGGCAATAATAGTGGGG,The sequences of CSB-D is TATTACTGGCATCTGGTTCCTA; The sequences of CSB-1 is ATATAATGCATGTTTTAATAACATA,The sequences of CSB-2 is TAAACCCCCCTACCCCC,The sequences of CSB-3 is TGTTAAACCCCTAAACCAG,The sequences of CSB-D and GTGGG-box are stringently conserved while a few site variations are found in other regions among species.