| The PCR-SSCP, PCR-RFLP , aPCR-SSCP, bioinformatics, DNA sequencingand DNA sequence analysistechniques were applied to scan and analyze the genetic variations of candidate gene and their association with economic trais in 1006 goats, which comprised of two cashmere breed, namely, Inner Mongolia white cashmere goat (IMWC, n=794) and ShanBei white cashmere goat (SBWC, n=212). The 6 candidate genes included 4 HGT-KAP genes in KAP gene family (the complete CDS region of KAP6.1, KAP6.2, KAP8.1 and KAP8.2 genes), MTNR1a gene (the exon 2), SS gene (the complete CDS region). The economic traits comprised of cashmere yield, cashmere thickness, wool length, weight, litter sizes, birth weight). The association between genetic variations and economic traits were analyzed by using general linear model (GLM) or adjusted linear model, as well as population genetic structure and distribution of genotype and allele were calculated by chi-square and quantitative genetic method. These will benefit for the protection, development and application of goat genetic resource, application of DNA marker related to economic traits on marker-assist-selection (MAS), and improvement and promotion of dairy goat, meat goat and wool goat. At the same time, the advantages and disadvantages of PCR-SSCP and aPCR-SSCP were discussed, in order to provide evidence for applification for two methods. The important results were in the followings:1. Genetic variation of 4 HGT-KAP gene and their assosiation between economic traits4 HGT-KAP genes of KAP gene family were researched in this experiment, namely, KAP6.1, KAP6.2, KAP8.1, KAP8.2. KAP6.1 gene and KAP8.2 gene were monomorphism in two breeds. There were 2 SNP and 1 deletional mutation in KAP6.2 gene, namely, c.119-142 del CAGGATACGGCTGTGGATACGGTT, c.174C>T, c.175A>G. The deletion mutations resulted in p. Ser 48_Gly55 del mutation, c.174C>T resulted in synonymous mutation, and c.175A>G resulted in p.59 Ser>Gly missense mutation. The two consecutive SNPs c.174C>T and c.175A>G were complete linkage and resulted in PvuⅡp olymorphism in KAP6.2 gene. The deletion region was 4 successive glycine-X dipeptides, which suggust there was size polymorphism in KAP6.2 gene. Two synonymous mutations were detected in KAP8.1gene, namely, c.63T>G, c.66C>G..It was worth noting that size polymorphism were detected in ShanBei White cashmere goat, but did not do in Mongolia White cashmere goat, while theχ~2 test showed that the genotype distributions in Shaanbei White cashmere goat breed was in agreement with Hardy-Weinberg equilibrium (P>0.05). Therefore the size polymorphism was considered as the breed characterization of Shaanbei White cashmere goat at KAP6.2 locus. This maybe caused by the breeding program of Shaanbei White cashmere goat. Chi-Square analysis of genotype and and allele frequencies distribution at two polymorphic loci of KAP6.2 gene showed that there were significantly different between Inner Mongolia White cashmere goat and Shaanbei White cashmere goat (P<0.01). Accoding to the previous researching result as well as the result of my experiment, it was presumed that KAP genes had more variation in different breeds, which resulted in the polymorphism of cashmere. The GLM analysis result between every polymophic locus and wool traits and weight in IMWC showed that different genotypes of KAP6.2 gene did not significantly affect on detected traits, while different genotypes of KAP8.1 gene significantly affect on wool length trait. Therefore, KAP8.1gene was considered as the candidate gene of wool length trait.2. Genetic variation of MTNR1a gene and their assosiation between economic traits13 SNP were detected in exon 2 of MTNR1a, in which 5 SNP were reported in other breeds and 8 SNP were reported at the first time. 7 T-C conversion between the pyrimidine, 3 A-G conversions between the purine, 2 T-G transversions, 1 A-C transversion. 12 SNP resulted in synonymous mutation, and 1 SNP resulted in p.59 Ser>Ile missense mutation.Different genotypes of MTNR1a gene did not significantly affect on wool traits and weight in IMWC (P>0.05), but MTNR1a-4-577 significantly affect on litter size and MTNR1a-4-589significantly affect on birth weight (P<0.05), therefore, MTNR1a-4-577 locus was considered as the candidate SNP of litter size trait and MTNR1a-4-589 locus was considered as the candidate SNP of birth weight. The main reason may be the mutation effected on the combining power between MT and MTNR1a, which resulted in litter size trait and birth weight trait.3. Genetic variation of SS gene and their assosiation between economic traitsSNPs were not detected at SS gene in two breeds. At present, few mutations of SS gene were reported. Compare of multisequencing showed, there are higher homology between species, pig, cattle, were complete the same as sheep in protein sequencing, while human was only different in a amino acids. SS is very important endocrine hormone, and it can inhibit lots of secretin. Because SS was important to maintenance and evolution of organism, there are higher homology between species and it was monomorphism between breeds. 4. Comparison of PCR-SSCP and aPCR-SSCPPCR-SSCP and aPCR-SSCP were compared in three loci and the result showed that PCR-SSCP is one of the most widely used methods to detect an unknown mutation for its inexpensiveness and convenience, but aPCR-SSCP which also can certify the result of PCR-SSCP and provides precise consequence, is an excellent method for complex loci. |
PDF Full Text Request