Pseudobagrus ussuriensis which belongs to Dsteichthyes,Actinopteri,Silurfor- mes,Bagridae. Pseudobagrus ussuriensis is a kind of important economic fish,which taste delicious and has high nutritional value. The success of its artificial propagation improved the status of its fry in short supply and accelerated the foundation of many small breeding populations. In limited of conditions and scales, many seed farm kept few parents and apart of them were offspring of their inbreeding. Its germ plasm, however, such as prematurity, the decline of hatching ratio,and the ability of disease resisitance and spawning has been seriously degenerating every year in recent years.In this study, the genetic structure and genetic diversity of Pseudobagrus ussuriensis were analyzed by mtDNA and SRAP.The main results were shown as follows:(1) The sequence-related amplified polymorphism(SRAP)molecular marker technique was used to compare genetic structures among three populations of Pseudobagrus ussuriensis-one wild and two cultured populations.Samples of two wild population were collected from HeiLongjiang and Jiangsu Hongze Lake,the two cultured populations from Fisheries Research Institute of Huaian (F2 generation) and Suzhou Dongshan Aquatic Breeding Plants (F3 generation). 12 pairs of SRAP primer, which produced good amplified patterns were selected from 100 primer combinations. 212 amplified loci were obtained from the three populations, among which 130 were polymorphic. The percentage of polyrnorphic loci in the HeiLongjiang (DB) population,Hongze Lake(HL) population, Huaian populations(HA), Suzhou Dongshan populations(SZ)were65.67%,63.13%,56.54%,54.88%,respectively. The results indicated that genetic polyrnorphism decreased in two cultured populations. The Nei's gene diversity of four populations were0.2597, 0.2641, 0.2546 and 0.2469, and the Shannon's Information index of four populations were0.4097,0.4118, 0.4050 and 0.3861, respectively. The genetic distance between two wild population was 0.1924, while the genetic simility was 0.6718; The genetic distance between two cultured population was 0.1087, while the genetic simility was 0.8970. The noticeable decrease in the number of rare loci and the increase in the number of homozygous recessive loci in the cultured population suggested a considerable loss of low frequency alleles in the cultured populations, which may have resulted from small effective population sizes during artificial seed production. With the method of UPGMA on the basis of genetic distanee,the results showed the populations of HA and SZ assemble done branch first, then with HL assemble done branch second, the last did DB populations because of these populations's the different sites. The results showed that: two wild populations has the largest genetic distance and the farthest genetic relationship, there is significant genetic differentiation; low level of genetic diversity of culture, and there was obvious genetic differentiation trend; but the genetic distance and genetic differentiation perspective Analysis, artificial breeding groups have not formed an independent genetic structure.(2) SRAP analysis was applied to study sex and genetic diversity in Pseudobagrus ussuriensis.A total of 60 samples,which are 30 males and 30 females,were used in the test.Of 100 random oligonueleotide primers for the amplification of Pseudobagrus ussuriensis genomic DNA,8 could produce reproducible, distinctive and characteristic bands from 572~111bp.164sites were deteeted,112 of which(68.29%) were polymorphic. Genetic diversity quantifled by Shannon index was 0.2917(male) and 0.2732(female) respectively. Only F10R6 primer was successful to amplify a specific band of 215 bp from male populations, named F10R6—215bp. This marker was not associated with male populations and can be used as SRAP marker for sex identification of Pseudobagrus ussuriensis.(3) Complete sequence of Pseudobagrus ussuriensis mtDNA control region is amplified and compared with sequence of Mystus macropterus,Leiocassis longrostris, Pseudobagrus tenuis and Pseudobagrus nitidus downloaded from GenBank.In analogy,the conserved region of these four species are identified as extended terminal associated sequenee,Certrol conserved sequence bloke,Conserved sequence block; These sequences of ETAS is TACATTAATTTACTATGGTATAGT; These sequences of CSB-F is ATGTAGTAAGAAACCATCAACCCTGTAT;These sequences of CSB-E is AGGGGCAAAACTTGTGGGGG;These sequences of CSB-D is TATTACTGGCATCT GGTTCCTA;These sequences of CSB-1 is ATAATATATGTATGTCTTAATGACATA; These sequences of CSB-2 is AAACCCCCCTACCCCC; These sequences of CSB-3 is TGTTAAACCCCTAAACCAG.The sequences of CSB-D and GTGGG-box are stringently conserved while a few site variations are found in other regions among species. |