Font Size: a A A

Oligonucleotide DNA Chip Based On ITS Region Polymorphism For Identification Of Bupleurum Plants-derived Crude Drugs

Posted on:2012-01-02Degree:MasterType:Thesis
Country:ChinaCandidate:L LiuFull Text:PDF
GTID:2214330368975673Subject:Pharmacy
Abstract/Summary:
Chaihu(Radix Bupleuri),a very commonly used crude drug with a history of more than 2000 years in traditional Chinese medicine,is famous for its effectiveness in effectiveness in treating common cold with fever,influenza,hepatitis,malaria and menoxenia.Its original herbs belong to Bupleurum L.,which is a large genus in family Apiaceae,with about 150 species worldwide.So far in China,42 species,17 varieties,and 7 forma of the genus have been reported.Although in the latest edition of Chinese Pharmacopeia,only Bupleurum chinese DC.and B.scorzonerifolium Willd.were listed as the officially approved source materials for Chaihu,due to the slightly different morphologic appearance of Bupleurum plants and markets,including B.loniradiatum Turcz.with toxic ingredients and B.hamiltonii Balak with very little active constituents.At these lead to confusion in the market,and uneven quality of the drug.It's urgently demanded appropriate efforts in the identification of Chaihu should be made to ensure its quality and safety.At present,the identification of Radix Bupleuri relies on the inspection of morphological characters or plant phytochemicals such as saikosaponin-a and saikosaponin-d.However,these approaches are not appropriate because the morphological and anatomical characteristice,as well as the chemical constituents,may very greatly during the course of plant development or post-harvest procession.Therefore,more objective and definitive,practical and conveninent approaches are necessary..Because of having many base information and good conservative on the length, ITS(internal transcribed spacer)region of Ribosomal DNA is particularly suitable for the study of phylogenetion and classification of plant on genera and group level.By sequencing ITS regions and comparing the sequences one another,we can differentiate Bupleurum samples and establish their identities.But almost all institutions at the grass roots in China can not afford a sequence machine;even the process of sequencing is too expensive for them.We have been pursuing other ways of facilitating the identification of Bupleurum plants-derived crude drugs.In the past few years,DNA chip has been proved to be a potential tool for the identification or authentication of medicinal herbs.Thus,in this paper,based on the polymorphism of ITS region,we further developed an oligonucleotide DNA chip for the identification of crude drugs derived from 6 Bupleurum species commonly seen and used in mainland China.1 PurposeIn view the feasibility of identification of medicinal herbs by ITS sequence and gene chip,in this study,varieties of Bupleurum were widely dietributed to be collected.We did the research on ITS sequence and gene chips to look for a more conveninent way of identification of Radix Bupleuri.2 Content2.1 Extracted DNA of Bupleurum samples,completed sequencing ITS and data analysis,evaluated the feasibility of identification of Radix Bupleuri by ITS sequence. 2.2 Based on the polymorphism of ITS region,further developed an oligonucleotide DNA chip for the identification of crude drugs derived from 6 Bupleyrum species commonly seen and used in mainland China,to prepare the methods and prospects of gene chip used in identification of Radix Bupleuri.3 Method3.1 Samples collectionIn this study,a large number of clear sources,correct identification of Bupleurum plant specimens were necessary,the main way to access including:l)Collected in the field;2)The collection in previous work,in particular using specimens in the possession of plant museums which collected many Bupleurum species,such as the college of Pharmacy,Fudan University,South plant institution,etc.3.2 DNA extraction and ITS amplification1)DNA extractions of 18 species of Bupleurum plant were performed using Plant Mini Kit,according to the manufacturer's instructions,with 1.2% agarose gel electrophoresis templated quality;2)The ITS sequence of extracted DNA was amplified using primers ITS5P,ITS4,primer sequences were:"ITS 5P"-5'>GGAAGGAGAAGTCGTAACAAGG<3',"ITS4"-5'>TCCTCCGCTTATTGATATGC<3'PCR amplification was performed in 25μl reaction mixtures containing 50-75ng of genomic DNA template,10×PCR buffer,0.2mmolL-1 of each dNTP,0.1×molL-1 of each primer,and 1.0U Taq DNA polymerase.PCR temperature cycles,consistedof an initial denaturation at 93℃for 5 min,55℃for 2 min,followed by 35 cycles of of 93℃for 30 sec,55℃for 45 sec,and 70℃for 45 sec,followed by a final estension at 70℃for 5min and chilling to 4℃。 3.3 PCR product purification and sequencingPCR products were purified by Gel Band Purification Kit,with 1.2% agarose get electrophoresis templated quality.Purified PCR products were sequenced in both directions with the primers used for PCR amplification.3.4 DNA sequence alignment and analysisCicuta virosa,which related to Bupleurum plants,was included as outgroup with ITS sequence analysis.Sequences were aligned ueing CLUSTAL X with the default settings.Nucleotide sequence divergences were calculated using the Kimura-two-par-ameter (K2P) distence model.A bootstrap (1000 replicates) neighbour-joining (NJ) analysis,performed in MEGA4.0,provided a graphic display of the patterns of divergence among the species.3.5 Design of Probes for DNA chipsSequence differences among ITS region of different Bupleurum species were thoroughly checked,and species-specific sequence polymorphisms were identified.Based on these polymorphisms,for each species,we desinged one or more primer(s) for its identification.3.6 Fabrication of DNA chips10μl solution of each probes and controls was loaded to a 384-well microplate,and was printed onto a substrate with an OmniGrid 100 microarrayer using MicroQuill 2000 array pins in a way shown in the schematic diagram. Spotted chip were placed in microarrayer for 0.5 hr for hydration,and dried at room temperature for 0.5 hr.The chip was then washed with B1 washing buffer for 5 min,rinsed with double-distilled water,and dried at room temperature.3.7 LabelingIn a 200μl PCR tube,50-100ng purified genomic DNA,d (AGT) TP 250μmol-1, dCTP 25μmol-L-1,Cy5-dCTP 2.5μmol·L-1,primers "ITS1 A"(5'-GGATATCCGTTGC CGAGAGT-3') and "ITS 5P" 0.6μumol·L-1 each,rTaq polymerase 2U,Mg2+ 2.5 mmol·L-1 and 10×PCR buffer 4μl were added, and adjusted to 40μl with double-distilled water. Labeling reaction was carried out as follows:93℃5 min, 55℃2 min; 93℃30 sec,55℃45 sec,70℃45 sec for a total of 35 cycles; 70℃7 min, kept at 4℃.PCR products were checked by 1% agarose gel electrophoresis.3.8 Hybridization, scanning7μl 2×hybridization solution,7μl fluorescence-lableled PCR products and 1μl positive reference CCOB (5'-Cy5-CCAAATCTCCAGGCATTGAGCGGGTT-3') were mixed together. After denatured at 95℃for 2 min, the mixture was cooled down immediately on ice bath; then it was transferred onto spotting area of the chip was rinsed with 0.2%SDS and double-distilled water successively, and then dried a little.Fluorescent signals of the hybridized DNA chips were detected by using a ScanArray 4000 microarray scanner.4 Results4.1 ITS sequence1)The length range of 18 species of Bupleurum was 599-609bp,(G+C)% content was 55.9%-59.3%; the maximum difference length of ITS1 region was 7bp,(G+C)% content was 59.8%-64.5%; the length range of 5.8 rDNA sequence was stability in 162-163bp, (G+C)% content of which 10 species was 53.4%; the maximum difference length of ITS2 region was 4bp, (G+C)% content was 54.2%-60.8%; (G+C)% content of ITS 1 region was higher than ITS2.2) When the Gap was treated as absence,the length of ITS sequences was 609 points, including 168 variable sites and 90 informative sites. The variation of 5.8 rDNA was less than other regions, the mainly variation transcribed in ITS1 and ITS2 regions, the variable sites of the two regions were 80 and 64, the proportion of informative sites were 21.6% and 16.7%, while there was only five informative sites of 5.8 r DNA sequence, so 5.8 rDNA was relatively conservative.The total length of Internal transcribed spacers (ITS1+ITS2) was 446bp, including 144 variable sites, 85 informative sites, the proportion of informative sites reached 19.1%.3)The genetic distance of 18 species of Bupleurum was 0.002-0.159. The distence of B.marginatum, B.marginatum var.stenophyllum, B.hamiltonii and B.petiolulatum var.tenerum to other species was 0.091-0.159, the distence between B.aureum to others was 0.071-0.159.The genetic distence between Cicuta virosa and Bupleurum was 0.341-0.406.4)Cluster analysis:Cicuta virosa and Bupleurum were clearly differentiated, each as a monophyletic tree; B.polyclonum was clusterd with B.chaishoui; B.longiradiatum f.australe was clusterd with B.longiradiatum; B.smithii was clusterd with B.smithii var.parvifolium; B.malconense was clusterd together with B.sichuanense, B.yinchowense and B.chinense. B.marginatum was clusterd together with B.marginatum var.stenophyllum, B.hamiltonii and B.petiolulatum var.tenerum.A2 DNA chipThe samples of Bupleurum collected from different locations gave same hybridization profiles. In some cases, besides the anticipated places, signals also appeared at places of other probes. Take B.chinense as an example. In its hybridization profile, florescence spots could be seen at places of both probes Sa2 and Sa4, although only probe Sa2 was designed for its detection, while Sa4 was for B.yinchouense,i.e.cross activity happened, but they could be differentiated by signal at the position of probe Sbl.5 Conclusion5.1 The ITS sequence of 18 species of Bupleurum have differences, ITS region sequences of Bupleurum species could be used to assist their identification.5.2 The chip can provide us with a credible and powerful tool for the identification of Radix Bupleuri.
Keywords/Search Tags:Radix Bupleuri, Identification, Internal transcribe spacer, DNA chip
Related items