| Flammulina velutipes was a low temperature type of edible mushroom, it required low temperature cold induced the formation of primoridia before the fruiting body to grow. Some function genes involves in the formation of primordia of flammulia velutipes, therefore need to find genes which plays important role in the primordia growth stages, and to study the mechanism of these functional genes. Histine kinase gene and GATA zinc finger transcriotion factor plays a crucial role in cold induced the formation of primordia of Flammulina velutipes. Histine kinase was a two component system, when the plant was in cold stimulation, itself will start the signaling pathway of feel the low signal and transmission the signal, the low temperature of external transmission to cells will induced the expression of genes. GATA zinc finger was a kind of important transcription factor, they generally have a zinc finger structure, it played an important role in the signal transduction pathway of cold induced mechanisms of plants.CRISPR/Cas9 system was a new gene editing techniques which developed in recent years, and was widely applied to a variety organisms. CRISPR/Cas9 system could play a role in gene editing that only need to have a Cas9 protein of nuclease function and a sg RNA having an identification and localization function. In this study, differentially expressed genes were obtained by bioinformatics analysis, CRISPR/Cas9 expression vector were constructed for the first time with the histidine kinase gene and transcription factor that were simultaneously transformed into Flammulina velutipes by the method of PEG, using the gene editing function of CRISPR/Cas9 to knockout the histidine kinase gene and transcription factor. The results of this thesis are shown as follows:(1) 7935 differentially expression genes were obtained by transcriptome sequencing, and then by comparing the transcription genomics and bioinformatics analysis, genes that involves in growth were found, two histidine kinase genes HK1 and HK2 and a GATA Zinc finger transcription factor which were down regulated expression in the primordia stage.(2) By the online design tool and the design principles of sg RNA, for the gene sequence of two histidine kinase genes and a GATA Zinc finger transcription factor, a sg RNA was designed, respectively. The target sequence were GATGGACAGCGGAAAATTGG, GTACCTGTTCGAATGAATGA and GTGGCCAAGCACTTGGAACA.(3) By the method of enzyme digestion connection and overlap extension PCR, six expression vectors were constructed, they were pgfvs-Cas9, p HK1-g RNA, p HK2-g RNA, p Zf-g RNA, pgfvs-Cas9-HK1-g RNA and pgfvs-Cas9-HK2-g RNA.(4) By protoplast monokaryoninzation, three monokaryontic strains were D-A, D-C, D-D. Through the fruting expression of mononuclear strains, determine the mononuclear strain was D-C for the transformation. By hygromycin B resistance screening, 50 μg/m L hygromycin B can completely inhibit the growth of mycelium and the growth of protoplast of Flammulina velutipes.(5) By PEG mediated protoplast transformation, the eukaryotic expression vectors CRISPR/Cas9 were co-transformed into the protoplast of Flammulina velutipes. Identifications of the putative transformants were performed by hygromycin B blotting and PCR analysis, there are eight and four positive transgenic strains with Cas9 gene which has integrated into the gonome of Flammulina velutipes, respectively. |