Flammulina velutipes, as one of the most popular edible fungi among consumers, is rich in amino acids, protein, and vitamins and nutrients, which has wide consumer market and development prospects. At present, Flammulina velutipes cultivation has entered the era factory, and the stain is the critical factor to decide the factory production. However, Flammulina velutipes belongs to low-temperature fructification mushroom whose fruiting body development needs hypothermia inducing, which increases the energy consumption of its cultivation factory. Therefore, exploring the mechanism of Flammulina velutipes fruit body development and revealing the key gene during the fruit body development are of important scientific significance and application value for directed genome evolution and cultivating high-temperature type strain. By transcriptome sequencing analysis of Flammulina velutipes during mycelium vegetative stage and primordia stage under low temperature inducing, combining with the related researches, the special transcription factor and the differentially expressed genes in important signaling pathways during body fruit development were selected as target genes, to construct the knockout expression vector with the latest genomic editing tools CRISPR/Cas9 system and then transformed into the mushroom protoplasts, with a view to exploring the specific functions of these differentially expressed genes during the fruit body development of Flammulina velutipes.The main results are as follows:1. Based on the transcriptome data analysis of mycelium and primordia of strain Fv-Yx, the transcription factor Mads8, the c AMP pathway gene N1477 and two-component signal transduction kinase gene HK535 were screened out from the differentially expression gene library. The differentially expressed genes Mads8 and N1477 were successfully cloned from the c DNA of strain Fv-Yx, while gene HK535 was electronic cloned by analysing the transcriptome data;(1)The length of gene Mads8 was 486 bp, it's expression level of mycelium was 9.4228 and primordium expression level was 30.0386, the logarithmic ratio of primordium and mycelium was 1.67, expression in primordium was significantly increased;(2)The length of gene HK535 was 750 bp, it's expression level of mycelium was 8.205 and primordium expression level was 19.6832, the logarithmic ratio of primordium and mycelium was 1.26, expression in primordium was significantly increased;(3)The length of gene N1477 was 906 bp, it's expression level of mycelium was 469.3943 and primordium expression level was 15.1009, mycelium expression was 30 times of primordium, the logarithmic ratio of primordium and mycelium was 1.26, expression in primordium was significantly reduced;2. Construction of co-transformation g RNA expression vector. Analysis of the target genes Mads8, N1477 and HK-535 was done through the g RNA online design website http://http://crispr.dbcls.jp/. g RNA expression vector pg RNA-Mads8, pg RNA-N1477 and pg RNA HK535 was successfully constructed by using H1 as promoter and GTGGCAGGGAACGCGTGAAAAGG?GTCTGTCCGACGTGCGAGCGTGG and GCCCGACCATGGCACGACACAGG as specific target site sequence.3. Construction of single-transformed expression vector. The recombinant vector pg Cas9-Mads8 and pg Cas9-HK535 were successfully constructed by integrating the g RNA expression vector pg RNA-Mads8, pg RNA-HK535 into plasmid pg Fv-Cas9 through PCR amplification and single enzyme-cut and link up using plasmid pg Fv-Cas9(containing the gpd promoter and Cas9 gene) as framework. The recombinant vector integrated Cas9 gene and target gene expression g RNA complete box.4. Screening of Fv-Yx monokaryons and hygromycin sensitivity measurement. Monocytes were prepared by protoplasts method, straing Fy74 was selected as the experimental material through mushroom fruiting experiment, and hygromycin sensitivity of the mycelium and primordia were measured. 50 ?g/m L was finally chosen as the screening concentration of proposed transformants.5. Co-transformation of expression vector and Fy74 protoplasts. Expression plasmid pg RNA-Mads8, pg RNA-N1477 and pg RNA-HK53 was co-transformed into the Fy74 protoplasts together with expression vector pg Fvs-Cas9 constructed by our laboratory by PEG-mediated method. 4, 5 and 3 proposed transformants were gained respectively after hygromycin medium screening and molecular identification.6. Single transformation of recombinant expression vector into Fy74 protoplasts. The recombinant expression vector pg Cas9-Mads8 and pg Cas9-HK535 was transformed into Fy 74 protoplast cells by PEG-mediated method and both were gain 2 proposed transformants after hygromycin medium screening and molecular identification.7. Knockout verification of the target site gene sequence of transformants. Knockout verification of of the target gene sequencing of the above obtained 16 positive transformants was done, and no gene mutation occured. |