Wood Identification For Lauraceae Species By DNA Technique

Wood anatomical features in the Lauraceae family are similar,making it difficult to use an anatomical characteristics method,DNA molecular marker was employed to identify exact species.a group of measures by adding ratio of wood powder to lysis buffer volume,incubating time,were modified to improve wood DNA extraction efficiency.The optimized CTAB-SDS,CTAB and kit for DNA extraction methods were used to extract wood DNA in Lauraceae,selecting and building the optimized wood DNA isolation protocol.RAPD and ISSR techniques,effective molecular markers for wood identification,were used to amplify wood DNA of 192 trees in 16 species of Lauraceae,the RAPD and ISSR fingerprints were built,and the difference between the two molecular markers were compared.By DNA barcoding technique,16 species could be distinguished and clusted by cloning and sequencing the fragment of psb A-trn H gene in chloroplast DNA.Conclusions are below:(1)a series of methods by adding ratio of wood powder to lysis buffer volume,incubating time and the composition of lysis buffer,improving the OD260/280 of wood DNA from 1.1-1.5to 1.8-2.0,were modified to improve the purity of wood DNA.(2)The content and purity of wood DNA extracted by three methods were difference,the optimized CTAB-SDS was the best for DNA extraction of Lauraceae.The content of DNA by optimized CTAB-SDS was highest,the lowest was kit;The purity of DNA by optimized CTABSDS and CTAB were good for amplification,the kit was bad.(3)Six ISSR primers(815,825,834,840,848,843)were screened and their amplification were stable,clear and high polymorphic,their annealing temperatures were 56?,54?,54?,54?,56?,54?.Through the six ISSR primers,96 bands were obtained,among which 86,89.6% in average,varying from 80%(primer 825)to 94.4%(primer 843),were polymorphic.DNA fragment size was 100 bp-2000 bp.These polymorphic bands amplified by primer 815,825,848,843 or the combination of primers 840 and 834 could distinguish the wood of these16 species in the Lauraceae family.(4)Eight RAPD primers(S22,S91,S35,S150,S221,S66,S85,S97)were screened and their amplification were stable,clear and high polymorphic,their annealing temperatures were both 38?.165 bands were obtained through the eight primers,among which 153,92.7% in average,varying from 83.3%(primer S221)to 100%(primer S91),were polymorphic.DNA fragment size was 100 bp-2000 bp.These polymorphic bands amplified by either one primer could distinguish the wood of these 16 species in the Lauraceae family.(5)ISSR and RAPD techniques were repeatable and stable,but different in polymorphism and detection level,the polymorphism of RAPD technique was higher,reflecting the abundant genetic diversity in lauraceae species.Using the combination of two molecular markers can make the wood identification more accurately.(6)The specific primer sequence used in psb A-trn H gene of Lauraceae species were GTTATGCATGAACGTAATGCTC(psb A)and CGCGCATGGTGGATTCACAATCC(trn H),the annealing temperature was 57?,the purpose DNA fragment size was 530 bp,The amplification was successful in all the 16 species.(7)16 species of Lauraceae family could be distinguished and clusted into 5 types by the sequence alignment analysis in psb A-trn H gene,which was similar to the traditional anatomical characteristics method.