Font Size: a A A

Silencing N-acetylglucosaminyltransferase V Enhances Cetuximab-induced Radiosensitivity Of Nasopharyngeal Carcinoma Through Glycosylation On EGFR

Posted on:2018-01-09Degree:MasterType:Thesis
Country:ChinaCandidate:X M HuangFull Text:PDF
GTID:2334330518465056Subject:Oncology
Abstract/Summary:
IntroductionNasopharyngeal carcinoma has a high morbidity in certain geographic areas like southern Asia,Mediterranean basin and southern China.According to the statistic issued by Chinese Cancer Registry Annual Report,the incidence rate of NPC in the registration was 3.61 per 100,000.Over 97%of patients is undifferentiated carcinoma and the major treatment of which is radiation therapy.However,not all the patients are sensitive to radiotherapy and over 40%of patients suffer distant metastasis and recurrence.Thus in the clinic,radiosensitizer is chosen to develop effective therapeutic strategies,resulting in better clinical outcomes.Cetuximab is an monoclonal antibody binding to EGFR and regarded as radiosensitizer in NPC treatment.Adding cetuximab as a radiosensitizer to first-line radiotherapy improved median overall survival(OS)from 29.3 to 49.0 months,and 5-year OS from 36.4%to 45.6%.The epidermal growth factor receptor(EGFR)belongs to ErbB family of receptor tyrosine kinase which involves in the pathogenesis and progression of different carcinoma types.The receptor is overexpressed in 80%-100%of head and neck cancer.EGFR is blocked by cetuximab,then it can’t be imported into the nucleus to activate of DNA-dependent kinase.That process inhibites DNA repair,and increases radiosensitivity of treated cells.Unfortunately,still a portion of the patients are insensitive to radiotherapy even after taking cetuximab.Therefore,it is necessary to fully invetigage the mechanism of radiosensitivity of cetuximab in NPC patients then selects those who may benefit from cetuximab.β1,6-N-acetylglucosaminyltransferase V,encoded by Mgat5,is an enzyme that adds GlcNAc in a β1,6-linked branches.Swainsonine inhibits Golgi a mannosidaseⅡ thus prevents the formation of β1,6-linked branches.Emerging lines of evidence suggest that GnT-V and its product β1,6-linked branches are elevated in various cancers and contributes to invasion and metastasis,including hepatocellular carcinoma,renal cell carcinoma,gastric cancer,breast cancer and so on.In addition,GnT-V increases expression of GlcNAc β1,6 complex-type N-glycans on cell surface receptors to affect chemotherapy resistance and radioresistance by activating signaling transduction.Moreover,suppression of GnT-V increase radiosensivity of small cell lung cancer,prostate cancerand nasopharyngeal carcinomahave been verified by our previous studies.Research purposeThe mechanism of cetuximab as a radiosensitizer remains to be explored.Alteration of branched N-glycans on cell surface receptors results in functional changes,and as cetuximab targets against EGFR,we wonder if there are any association between glycans and cetuximab.Thus we supposed that GnT-V may participate in radiosensitivity induced by cetuximab via altering β1,6-linked branches on EGFR.Materials and methodsCell culture and lentivirus transfectionHuman nasopharyngeal carcinoma cell lines CNE1,CNE2,HNE1 were purchased from Shanghai Cell Bank of Chinese Academy of Sciences,matining in 10%fetal bovine serum in RPMI1640 medium(Gibco,USA),penicillin and streptomycin at 37℃ with 5%CO2 incubator.CNE1 and CNE2 cell lines were seeded in 24-well plate with density of 5 x 104 and transfected with recombinant lentivirus LV3(H1/GFP&Puro)-has-GnT-V2224(5’-3’ CTCCTTTGACCCTAAGAAT),LV3(Hl/GFP&Puro)-has-GnT-V1564(5’-3’GGAAGTGCATGCAACTGTTTA)and LV3(H1/GFP&Puro)-has-GnT-V NC(5’-3’TTCTCCGAACGTGTCACGTTTC)to down-regulate GnT-V according to the instruction of manufacturer(Gene-Pharma,China).The transfected cells of stable expression GnT-V shRNA and controlled shRNA were obtained under puromycin(1μg/ml)and namely CNE1-NC,CNE1-1564,CNE1-2224;CNE2-NC,CNE2-1564 and CNE2-2224 separately.Gene expression was confirmed by both western-blot and RT-PCR 3 days after transfection.Drug preparationCetuximab(C225,Merck KgaA,Darmstadt,Germany)was received as an infusion concentration of 5mg/ml,then diluted with PBS(in vitro experiments)or NaCl(in vivo experiments).In vitro experiments,final cetuximab dilutions of one fifth IC50 was used and in vivo experiments concentration of 50mg/kg was used in each xenograft model.Swainsonine(Sigma-Aldrich,St.Louis,USA)was diluted with ultrapure water to give a stock solution of lmg/ml.The concentration used in vitro and in vivo experiment was 1μg/ml and lmg/kg separately.RNA extraction and RT-PCR analysisTotal RNAs extraction from CNE1,CNE2,HNE1 were obtained by Trizol Reagent(TaKaRa Biotechnology,Dalian,China)according to the manufacturer’s protocol.The total RNA was reverse transcribed to cDNA by a commercial kit following the manufacturer’s instructions(TaKaRa,Dalian,China).The mRNA expression level was assessed by a SYBR Primescript RT-PCR kit(TaKaRa).Glyceraldehyde-3-phosphate dehydrogenase(GAPDH)was used as the endogenous standard.The primer sequences used in the experiments were listed in Table below.Western blot analysisCell lysate containing equal amounts of protein were separated using SDS-PAGE,transferred to a polyvinylidene difluoride membrane(Millipore,Massachusetts,USA).After blocking with 5%bovine serum albumin,the membrane was treated overnight at 4 centigrade with appropriate specific antibody or biotinylated lectin,then was stained with the appropriate secondary antibodies.Immunoreactive bands were visualized by using an enhanced chemiluminescent(ECL)detection reagent(Millipore).The relative expression was normalized to GAPDH.Primary antibodies used here include GnT-V(Abcam,London,UK),EGFR(Cell Signaling Technology,Danvers,MA,USA),AKT(Cell Signaling Technology,USA),P-AKT(Bioworld,Minnesota,USA),P-PI3K(Bioworld),GAPDH(Bioworld),biotinylated PHA-L(Vector Laboratories,Burlingame,CA).Lectin blot analysisCells were harvested and lysed then proteins extracted from the cells were electrophoresed on 8%SDS-PAGE as the same way described for western blot analysis.After blocking with 5%bovine serum albumin in PBS containing 0.5%(w/v)Tween 20.Then PVDF membrane were incubated with lOug/ml biotinylated L-PHA(Vector Laboratories,Burlingame,CA)overnight and detected by using enhanced chemiluminescent(ECL).PHA-L precipitationFor lectin precipitation of EGFR,cell lysate(600ug)in RIPA buffer were added to 60ul agarose-bound PHA-L lectin(Vector Laboratories,Burlingame,CA)and incubated overnight at 4 centigrade under agitation.After Collecting the agarose beads by centrifugation(5 seconds in the microcentrifuge at 14,000 rpm),discarded the supernatant and wash the beads 3 times with ice-cold PBS.N-linked β(1,6)-branching on EGFR was then detected by using antibody against EGFR after SDS-PAGE and membrane transfer.Cell proliferation assay(CCK-8)Cells were seeded in 96-well plates at 2000 cells/well for 24h,followed by exposing to 6 GY of irradiation.24h later,lOul of Cell Counting Kit-8 solution(Dojindo,Kuamoto,Japan)and 100ul RPMI-1640 plus 10%FBS were added to each well.Incubating for 120min,the plate was measured at 450nm absorbance to calculate the relative viable cells subsequently.Colony formation assay300 cells were seeded in 6-well plates and exposed to 6Gy radiation then incubated for 14 days afterwards.Next,colonies were then washed,fixed,paraformaldehyde,and stained.The colony-forming rate = the numbers of colonies at 0 Gy/the numbers of cells seeded at 0 Gy.Survival fraction(SF)= the numbers of colonies at x Gy/(the numbers of cells seeded at x Gy x colony-forming rate)[2].Wound healing assayCells were seeded in 6-well plates then grown to a monolayer.The wound areas were scraped using 200-ul plastic tips.At the indicated times(0h,24h,48h,72 h for CNE-1 cells or 0h,24h,48h for CNE-2 cells),photographed the wound areas and caculated the wound healing rate.Flow cytometry assayCells were harvested after 24 hours being 6Gy radiated,then washed with PBS and resuspended in binding buffer containing 7-AAD(BD Pharmingen,Santiago,CA,USA)for 10 min,followed by the addition of Annexin V-PE.Cell apoptosis analysis was carried out using a flow cytometer(BD Biosciences,Oxford,United Kingdom).Immunohistochemistry stainingMice tumor tissues were deparaffinized and rehydrated routinely.After blocking with 7%bovin serum albumin,the tissue sections were incubated with primary antibodies specific to EGFR(1:50,Cell Signaling Technology)and PHA-L(1:100,Vector Laboratories)at 4℃ overnight.Being washed three times with PBS(Gibco,New York,USA),the tissue sections were then incubated with horseradish peroxidase labelled secondary antibodies(1:2000,ZSGB-BIO,Beijing,China),according to the manufacturer’s instructions.Brown-yellow granules in the nucleus were considered positive staining for EGFR and PHA-L,negative controls were performed by replacing the primary antibodies with PBS.In vivo tumorigenicity assay and fractional radiationMale nude mice(4-6 weeks old,12-18 g)were purchased from the animal facility of Sun Yat-Sen University in Guangzhou,China.And all animal experiments were approved by the Animal Ethics Committee of the Sun Yat-Sen University.After the stable transfected cells(6×106)were harvested,they were re-suspended in 200ul PBS and injected into the left side of each mice.When tumors reached volume of~100mm3,the treatment was initiated[3].Cetuximab(Merk KgaA,Darmstadt,Germany)was given at a dose of 50mg/kg and swainsonine(Sigma-Aldrich)was given at a dose of lmg/kg via i.p.injection 6 hours before radiation on days 1,3,5.Radiation therapy was administered as 2 Gy fractions on days 1 to 5.Tumor dimensions were measured twice weekly and the volume was calculated according to this equation:V=1/2(W2xL),where L and W are the longer and shorter dimensions of the tumor,respectively.Statistical analysisData were conducted with SPSS 19.0 software and were reported as means ± SD.Statistical analysis between the groups were analyzed with multi-way classification ANOVA or χ2-test.All tests were two sides and P<0.05 was considered as significant difference.Result1.Lentivirus-mediated shRNA inhibited GnT-V mRNA and protein level in NPC cell lines.To determine the expression level of GnT-V in CNE1,CNE2 and HNE1,RT-PCR and western blot analysis were used.CNE2 expresses the highest and HNE1 expresses the lowest of GnT-V among these 3 NPC cell lines in mRNA and protein level.Thus we chose CNE-land CNE2 in the subsequent lentiviral transfection experiment to develop suppressed GnT-V cell models,namely CNE1-1564,CNE1-2224,CNE2-1564 and CNE2-2224,the mRNA expression level of which were 36.3%,33.9%,42%,35.5%separately compared with respective control groups.Similarly,the protein level of CNE1-1564,CNE1-2224,CNE2-1564 and CNE2-2224 decreased by 60.13%,59.89%,43.67%and 46.18%separately.The negative control groups and the nontransfected cells were not significantly different(P>0.05).2.Cetuximab further sensitized NPC cells to radiation after GnT-V knocked down.To determine the concentration of cetuximab employed in our experiments,CCK-8 assay was used to find out half maximal inhibitory concentration(IC50)of cetuximab in CNE1 and CNE2.IC50 of CNE1 and CNE2 was 717μg/ml and 1244μg/ml respectively.One fifth of cetuximab’s IC50 in CNE1(143μg/ml)and CNE2(249μg/ml)was selected to be the experimental concentration.Afterwards,one fifth of cetuximab’s IC50 was added to NPC cells and discovered that low concentration of cetuximab hardly had any effect on cell viability of CNE1 and CNE2.To explore the interaction among GnT-V,cetuximab and radiation,we performed colony formation assays,wound healing assays,cell proliferation assays and flow cytometry assays to assess the radiosensitivity.6Gy of radiation does was chosen in the majority of experiments as our research group previously found out that the most significant distinction exited between 6Gy and OGy in NPC cells.Colony formation assays were performed with various doses of irradiation(OGy,2Gy,4Gy,6Gy,8Gy).Survival fractions decreased with the increasing irradiation in both CNE1 and CINE2.In each group,CNE2-NC ranked first.CNE2-2224 was more than CNE2-2224/cetuximab.In addition,CNE2-NC/cetuximab dropped compared with CNE2-NC.The SER was 3.23.Just as CNE2,survival fractions of CNE1-NC was higher than CNE1-NC/cetuximab and CNE1-1564.Survival fractions of CNE1-1564 was higher than that of CNE1-1564/cetuxiamb.The SER was 2.42.Therefore,with irradiation,down regulation of GnT-V decreased NPC cells’ clonogenicity,moreover,it was further reduced when combining cetuximab.Wound healing assays in Figure 2D shown the mean healing rates of CNE2-1564 and CNE2-2224 were lower than CNE2-NC.Moreover,the rates of CNE2-1564/cetuximab and CNE2-2224/cetuximab were lower than those of CNE2-1564 and CNE2-2224.Similarly,healing rate of CNE2-NC/cetuximab was reduced compared with CNE2-NC after 6 Gy radiation.The outcome of CNE1 cell line was alike.The apoptosis rates of cells with radiation treatment was measured by flow cytometry as well.Lower expression of GnT-V accompanying cetuximab cells showed a modest increase in apoptosis rate compared with solely down-regulated cells or control cells.CCK-8 assay revealed that relative cell viability of CNE2-NC exceeded CNE2-1564 or CNE2-2224,while CNE2-1564 and CNE2-2224 outnumbered CNE2-1564/cetuximab or CNE2-2224/cetuximab after being exposed to 6Gy radiation.Viability rate of CNE2-NC was also increased compared with CNE2-NC/cetuximab.The parallel result was also discovered in CNE1 cells,down-regulated GnT-V cells plus cetuximab further decreased the viability rate by comparison with NC group.To sum up,down-regulated GnT-V combining cetuximab decreased migration and survival fraction and enhanced radiation-induced apoptosis,thus sensitizing NPC cells to radiotherapy collectively.3.Cetuximab with irradiation promoted aberrant β1,6 branches on EGFR.Next,to verify β1,6-linked branches were involved in radiosensitivity in NPC cells,we used N-oligosaccharide chain inhibitor swainsonine(1μg/ml)to inhibit β1,6-linked branches of CNE2 that highly expressing GnT-V.In clone formation assays,after being exposed to 0,2,4,6,8 Gy separately,survival fractions from most to least were CNE2,CNE2/cetuximab and CNE2/cetuximab/sw.In wound healing assays with radiation of 6Gy,the speed of migration from fast to slow were CNE2,CNE2/cetuximab and CNE2/cetuximab/sw successively.Analogously,in CCK-8 assays relative cell viability of NPC’s cells from most to least were CNE2,CNE2/cetuximab and CNE2/cetuximab/sw as well.In the contrary,the apoptosis rate ranking from high to low was CNE2/cetuximab/sw,CNE2/cetuximab and CNE2.These data provided a notion that inhibition of β1,6-linked branches sensitized NPC cells to irradiation,thus β1,6-linked branches might have influence on radiosensitivity.To further investigate whether radiosensitivity of NPC cells were aroused via alteration of β1,6 branches on EGFR,we firstly detected expression of EGFR by RT-PCR and western blot in each group.As demonstrated in Figure 4E,expressions of EGFR among groups were invariant.Then,lectin blots were performed and showed the total β1,6 branches of each group was various.CNE2-NC owned the most β1,6-linked branches,while CNE2-1564 and CNE2-2224 had more β1,6-linked branches than those of CNE2-1564/cetuximab and CNE2-2224/cetuximab.The result of CNE1 was consistent with above outcome.That meant cells more sensitive to radiation were negatively related to β1,6 branches while those insensitive ones were positively correlated with β1,6 branches.Meanwhile,L-PHA precipitation,blotting and probing with anti-EGFR staining were carried out and a significant decrease was observed in cells which were more responsive to radiotherapy,implicating that cells down-regulated GnT-V combining cetuximab leaded to even lower amount of β 1,6 branches glycans on EGFR than cells solely down-regulated GnT-V.Cetuximab with irradiation promoted aberrant β 1,6 branches on EGFR.The conclusion from the above analysis was that aberrant β 1,6 branches on EGFR contributed to radiosensitivity related to cetuximab and GnT-V.4.Down-regulated GnT-V combining cetuΟimab in radiotherapy decelerated tumor growth.The efficacy of down-regulated GnT-V combining cetuximab on tumor growth was also explored in xenograft nude mice with radiotherapy.2Gy of irradiation was given on day lto 5 and cetuximab was given on day 1,3,5.As shown in Figure 3A&B,tumors with down-regulated GnT-V combining cetuximab grew the slowest,while the NC group grew much faster than either down-regulation of GnT-V group or cetuximab alone group.Similarly,tumors with glycosylation inhibitor swainsoniene and cetuximab grew the slowest.Further more,the expression of Bcl-2 level in tumor xenografts was also detected.Groups of cetuximab combining down-regulated GnT-V or swainsonine ranked last in Bcl-2 protein level.We also detected levels of β1,6 branches by immunohistochemistry in xenograft tumors,the results were consistent with finding in vitro.Therefore,the result suggested that cetuximab with knocked-down GnT-V enhanced the response to radiation in nasopharyngeal cancer cells and decelerated tumor growth.5.Reduced P 1,6 branches on EGFR decreased the PI3K/AKT signaling.Accumulating evidences have confirmed that PI3K/Akt signaling is overactive in radioresistance of head and neck squamous cell carcinoma.β1,6 branches generated by GnT-V belongs to N-glycans and EGFR is a member of receptor tyrosine kinases(RTK).It is reported that N-linked glycosylation affects RTK signaling and sensitizes tumor cells via Akt.Accordingly,we proposed that if irradiation-induced alteration of β1,6 branches on EGFR might influence its downstream signaling or not.Cells were all treated with 6Gy irradiation before lysed.Western blot revealed that total Akt was invariant in different group,however,the phospho-Akt and phospho-PI3K were varying(Figure 3-5).CNE2-1564 and CNE2-2224 were lower than CNE2-NC,CNE2-1564/cetuximab and CNE2-2224/cetuximab were lower than those of CNE2-1564 and CNE2-2224.CNE2-NC/cetuximab was reduced compared with CNE2-NC.The result of CNE1 group was alike.In brief,irradiation-induced alteration of β1,6 branches on EGFR might influence the PI3K/AKT signaling.Conclusion1.Lentivirus-mediated shRNA inhibited GnT-V mRNA and protein level in NPC cell lines.2.Cetuximab further sensitized NPC cells to ionizing radiation after GnT-V knocked down.3.Cetuximab with irradiation promoted aberrant β1,6 branches on EGFR4.Radiotherapy combining down-regulated GnT-V and cetuximab decelerated tumor growth.5.Reduced β1,6 branches on EGFR decreased the PI3K/AKT signaling.6.GnT-V could be regarded as a biomarker when deciding to use cetuximab in radiotherapy.
Keywords/Search Tags:KDYWORDS, GnT-V, C225, Radiosensitivity, EGFR, β1-6 branches
Related items