Effect Of HMG-COA Reductase Gene Polymorphism On The Rate Of Reaching Lipid Target In Hyperlipidemic CHD Subjects Using Atorvastatin

The aim of pharmarcogenomics is to investigate the relationship between polymorphisms on human genome and the variability of response to a specific drug in population, to achieve further insight into mechanism of a disease and mechanism of different drug responses, and eventually to guide individualized clinical practice medications.Statins are inhibitors of HMG-COA reductase. They can prevent and treat atherosclerosis by lowering cholesterol. It hasbeen hypothesized that HMG-COA reductase gene polymorphisms have effect on HMG-COA reductase activity, which may in turn influence the cholesterol levels inside and outside the cell. To date, no report is seen on the association between the genetic polymorphism of HMG-COA reductase and the dose-response efficacy of statin on cholesterol lowering.Objective: To study the genetic distribution of HMG-COA reductase polymorphisms in Chinese people and their relationship with plasma lipid level, and with dose-response effects of statin on lipid lowering. The results can provide basis for the individualized medication and the use of this genetic screening to guide selection of lipid-lowering therapy.Methods: The current study was divided into two parts: Experiment One, the relationship was further investigated of ScrFI restriction fragment length polymorphism (RFLP) with coronary heart disease, and their lipid levels. The subjects were enrolled from 10 hospitals in Beijing, from December, 2003 to April, 2004 including 70 CAD patients, 93 hyperlipidemic patients, and 107 healthy controls. All CAD patients were approved by coronaryangiography with more than one native coronary segment with a stenosis >50%. Hyperlipidemia was defined as total cholesterol (TC) >5.72mmol/L and low-density lipoprotein ( LDL-C ) >3.64mmol/L or triglycerides (TG) >1.7mmol/L as patients were admitted. The healthy controls were confirmed with no CHD or hyperlipidemia by inquiring about history of illness, medical examination, X-ray of chest and plasma lipids test. Risk factors and history of diseases were evaluated using questionnaires.In the morning blood samples were collected into tubes containing 0.1% EDTA for lipids testing or lithium tubes containing frost heparitin for DNA extraction. Samples in lithium tubes containing frost heparitin for gene analysis were stored at -70 °C in the icebox prepared for extracting DNA by salt-out method, which was used for HMG-CoA reductase genotype in ScrFl polymorphic filtered. Lipids testing was performed within 12-24 hours after blood collection. Lipids, including TC, LDL-C, TG, and HDL-C were measured at baseline with enzyme method, 4 weeks, and 8 weeks after enrollment. The following was the measurement for HMG-CoA reductase genotype in ScrFlpolymorphic. lntron 2 of HMGCRG included 1.1kb fragment in ScrFI polymorphic site was performed using polymerase chain reaction (PCR) screening.Genotyping of the HMG-CoA ScrFI RFLP was performed by PCR and restriction enzyme digestion. We first amplified the 1.1kb fragment in intron 2 containing the AcrFl polymorphic site, the primers for PCR were as follows: 5' - TACTGGTAACAAT-AAGATCTGTGGT-3' and 5' - ATATTTTGATCCAAGTTGAC -GTAAA-3' . The composition of PCR reaction system was 0.2ug DNA template, 0.4umol/L primer, O.lmmol/L dNTPs, LOU TaqDNA polymerasexbuffer (included 1.5mmol/L MgC12). Each PCR amplification was done in PTC-200 Heat Cycle Instrument.The condition of PCR was: 94°C4 min pre PCR, then denaturationat95°C for 40s, annealing at 62 °C for 45 s, annealing at 72 °C for 72 °C 2min, after 35 cycles , annealing at 72 °C for lOmin. lOp.1 PCR product and restriction endonucleases ScrFI (CCNGG) were warmed at 37°C overnight, then, 42~430bp product after enzyme-cut was analyzed by 8.0%Polyacrylamide Gel Electrophoresis (PAGE). There are two polymorphic type, one is 165bp DNA fragment(allelic frequencies of A), the other is 45bp DNA fragment (allelic frequencies of a). They have in common 430, 380, 90, 88, 68, 50, 45 and 42bp for unpolymorphic fragment.Genotype and allelic frequencies were calculated by gene counting. The concordant degree between genotype frequencies and Hardy- Weinberg equilibrium, the differences of genotype as well as allele frequencies among cases and controls were examined. Levels of blood lipid among cases and controls were compared by t test. The relationship of HMGCRG polymorphism and blood lipid at baseline and dose-effect of atorvastatin was compared by angular transformation (ANOVA).Experiment two: Two SNPs (SNP 12 and SNP 29) on HMG-COA gene and their effects on the rate of reaching the lipid target in huperlipidemic CAD patients were further investigated by using atorvastatin. Sixteen patients were enrolled into this study as planned from 10 hospitals in Peking during 6 months. The design of the study was used with block randomization by matched pairs,the number of block subject is 4, finally, 120 subjects were obtained effectively. All centers performed clinical research following good clinical practice (GCP). This study was open, randomized, multicentered, and the longest time was 8 weeks. The patients enrolled were randomly divided into atorvastatin 20mg/d group or atorvastatin lOmg/d group. All subjects must sign a form to their consent before participation in the study.During investigation, the investigator should guide patients to control food and persuade them to follow the regulation of NCEP I for food controlled. The patients were ordered for medical examination, and the history of illness and incidental medication during study were recorded on the case reports. The blood samples were collected at 4, 8 week after the start of the experiment, and blood lipid and SNP12, SNP29 polymorphism of HMG-CoA reductase gene were measured.HMG-CoA recuctase SNP12 gene located in 74726928 site of the fifth chromosome 74726928 (Human genome July 2003 UCSC version hgl6, based or build 34 , NCBI) , the mutation of alkali chains was A/T, and the sequence wasAAAAAAAAATTTTTT (AT) AAATCCTTTATATTA. Sequence of primer was 5'-GGTTGCAGTGAACCAAGATCACA-3'and 5'-CAATGAAGGCAAGGGACAGAAC-3'. HMG-CoA recuctase SNP29 gene located in 74726928 site of the fifth chromosome 74739571 (Human genome July 2003 UCSC version hgl6, based or build 34, NCBI) , the mutation of alkali chains was T/G, and the sequence was TTTTCCAAACTCTTT (TG) GTCATATCAGCC-TAA. Sequence of primer was 5'-GGCATAGAGTCCACAAGCC-TAGT-3' and 5-ACTTGACAGCCACACCTGACAGT-3'.The sequences of PCR product were examined with Dideoxy sequencing method of Sanger by Beijing Sino Geno Max Co. Ltd. Dideoxynucleotide sequencing represents only one method of sequencing DNA. It was commonly called Sanger sequencing since Sanger devised the method. This technique utilizes 2', 3'-dideoxynucleotide triphospates (ddNTPs), molecules that differ from deoxynucleotides by having a hydrogen atom attached to the 3' carbon rather than an OH group. These molecules terminate DNA chain elongation because they cannot form a phosphodiester bond with the next deoxynucleotide. In order toperform the sequencing, one must first convert double stranded DNA into single stranded DNA. This can be done by denaturing the double stranded DNA with NaOH. A Sanger reaction consists of the following elements: a strand to be sequenced (one of the single strands which was denatured using NaOH), DNA primers (short pieces of DNA that are both complementary to the strand which is to be sequenced and radioactively labelled at the 5' end), a mixture of a particular ddNTP (such as ddATP) with its normal dNTP (dATP in this case), and the other three dNTPs (dCTP, dGTP, and dTTP). The concentration of ddATP should be 1% of the concentration of dATP. The logic behind this ratio is that after DNA polymerase is added, the polymerization will take place and will terminate whenever a ddATP is incorporated into the growing strand. If the ddATP is only 1% of the total concentration of dATP, a whole series of labeled strands will result. Note that the lengths of these strands are dependent on the location of the base relative to the 51 end. This occurs because a phosphodiester bond cannot form between the dideoxynucleotide and the next incoming nucleotide, and thus the DNA chain is terminated.Results: The resultes of experiment one and experiment tow are listed as below : (D It was found in Part I with 70 CHD patients and 93 hyperlipidemia patients that there was no association with HMGCRG ScrFl polymorphism among CHD and hyperlipidemia and TC, TG, LDL-C and HDL-C. But, there were correlation between HMGCRG ScrFl polymorphism and ApoA. (2) The results of Part II showed rate of reaching target lowering blood lipid by atorvastatin in CHD with hyperlipidemia. The rate of group with atorvastatin 20mg was 83% and that with lOmg was 77%, there was no significant difference. (D The relationship between baseline lipid levels and lowering-lipid therapy with atorvastatin showed positive correlation. ? HMGCRG SNP12, SNP29 polymorphism was not found in all 120 patients enrolled.Conclusion: Subtle genetic change may induce change of medical effect, but this change has no connection with basic pharmacokinetics and pharmacodynamics. This study confirmed the current knowledge of no close relationship between HMGCRG genetic ScrFl, SNP12, SNP29 polymorphism and levels of blood...